Id PubMed PubMed ID Name obj 1 Type obj 1 Name obj 2 Type obj 2 Interaction Material Method
0e44feaa-97a0-4a9e-837e-bb6e1db17e0234201561342015612-{3-[(2-{4-[4-(hydroxynitroso)phenyl]-1,3-thiazol-2-yl} hydrazin-1-ylidene) methyl]-4-methoxyphenyl} benzamide bromidechemicalRTproteinunknownUnless otherwise noted, starting materials, reagents and solvent were obtains from commercial suppliers are reagent grade and were used without purification. All melting point were determined by the capillary method on a Büchi-540 capillary melting points apparatus (BÜCHI Labortechnik AG, Meierseggstrasse, Switzerland) and are uncorrected. All samples were measured in DMSO-d6 solvent at 278.1 K temperature on a Bruker AVANCE III spectrometer (Billerica, MA, USA). In the signal assignments the proton and carbon chemical shifts are referred to the solvent (1H: d = 2.49 ppm, 13C downfield methyl signal: d = 34.89 ppm, respectively). Chemical shifts are reported in parts per million (ppm, δ units). Coupling constants are reported in units of Hertz (Hz). Splitting patterns are designed as s, singlet; d, doublet; t, triplet; dd, double doublet; m, multiplet; b, broad.All reactions were carried out with the use of the standard techniques and were monitored by thin-layer chromatography (TLC) on silica gel plates (60F-254, E. Merck, Merck Group, Darmstadt, Germany), and spots were visualised by UV light.Synthetic Procedures. HIV-1 RT-Associated DNA Polymerase-Independent RNase H Activity Determination. HIV-1 RT-Associated RNA Dependent DNA Polymerase Activity Determination. Molecular Medelling - Ligand Preparation, Protein Preparation, Docking Experiments, The resulting best complexes were considered for the binding modes graphical analysis with LigandScout (inte:Ligand, Vienna, Austria) and Ligand Interaction module included in Maestro GUI.
a13050ab-ba88-47b3-9445-b02925640bba3010563130105631LSD1proteinhistone lysine demethylase 5AproteinunknownThe mammalian expression plasmids were prepared as follows: pCMV-myc-LSD1 was generated by PCR; pcDNA3.1-Tat K50A-flag, pcDNA3.1-Tat K51A-flag, and pcDNA3.1-Tat K50/51A-flag were generated by sitedirected mutagenesis; pGL3-NL-4.3-LTR ΔSp1 mutation was generated by deletion of Sp1-binding site nucleotides via site-directed mutagenesis (Thermo Fisher); pLKO.1- shLSD1 targeting LSD1 (CCACGAGTCAAACCTTTA TTT) was cloned into the pLKO.1 vector; and pcDNA3.1- Tat-flag, pRL-TK, and pGL3-NL-4.3-LTR were prepared as previously described.The mammalian expression plasmids were prepared as follows: pCMV-myc-LSD1 was generated by PCR; Cells were fixed in 1% formaldehyde for 10 min at room temperature. Then, the cells were lysed and the nuclear extracts sonicated for 20 min. Sheared cross-linked chromatin was incubated with 1–4 µg of the indicated antibody and 20 µl of fully resuspended protein A/G beads for 3 h at 4 °C with rotation. The beads were washed and incubated with elution buffer at 62 °C overnight. Free DNA was obtained and analyzed using qRT-PCR equipment
d186bd7e-8581-41c9-a83b-6943489656b73008969430089694PF74proteinHIV-1 capsidproteinunknownLyophilized purified recombinant WT HIV-1 capsid proteins were resuspended in storage buffer (20 mM Tris-HCl at pH 8.0, 40 mM NaCl, 60 mM β-mercaptoethanol) to a final concentration of 160 μM. Resuspended CA proteins were self-assembled using a previously described method (3). Briefly, CA suspension was placed in dialysis minicups (Slyde-A-Lyzer Mini; Thermo Scientific) and dialyzed overnight against CAB (100 mM Tris-HCl at pH 8.0, 200 mM NaCl) at 4°C. CA assemblies were then characterized by AFM.Isolation of HIV-1 cores. AFM measurements and analysis.
a21e6929-b342-4ffc-8655-d172d438ee4d2995445629954456UPF1proteinUPF2proteinunknownHEK293T cells were purchased from the American Type Culture Collection (ATCC). TZM-bl HeLa cell line was obtained from NIH AIDS Reference and Reagent Program. Both of these cells lines were grown in Dulbecco’s modified Eagle medium (DMEM, Invitrogen) containing 10% fetal bovine serum (HyClone) and 1% penicillin–streptomycin (Invitrogen). PBMCs were isolated from leukophoresed blood collected from healthy donors. All subjects provided informed consent for participating in this study. The research ethics boards of the recruiting sites, the Centre Hospitalier de l’Universite de Montreal and McGill University Health Centre approved this study. PBMCs were isolated by density-gradient centrifugation using lymphocyte separation medium (Corning). CD4+ T cells were negatively selected using the EasySep human T cell enrichment kit according to manufacturer’s protocol (StemCell). Gene silencing. Transfections. Viral transduction. HIV-1 virus production and infection. Western blotting. FISH-flow. Confocal microscopy following FISH-flow. RT-qPCR. All experiments were performed in triplicate, and the data are presented as the mean ± standard deviation (SD). A p value of < 0.05 in a student’s t-test, one-way or two-way ANOVA test was considered statistically significant. GraphPad Prism 6 (Graphpad Software Inc.) was used to conduct statistical analyses and create graphs.
9f72104e-e0c2-42d2-9eb3-5fbc2c99ed0f2995445629954456UPF1proteinSMG6proteinunknownHEK293T cells were purchased from the American Type Culture Collection (ATCC). TZM-bl HeLa cell line was obtained from NIH AIDS Reference and Reagent Program. Both of these cells lines were grown in Dulbecco’s modified Eagle medium (DMEM, Invitrogen) containing 10% fetal bovine serum (HyClone) and 1% penicillin–streptomycin (Invitrogen). PBMCs were isolated from leukophoresed blood collected from healthy donors. All subjects provided informed consent for participating in this study. The research ethics boards of the recruiting sites, the Centre Hospitalier de l’Universite de Montreal and McGill University Health Centre approved this study. PBMCs were isolated by density-gradient centrifugation using lymphocyte separation medium (Corning). CD4+ T cells were negatively selected using the EasySep human T cell enrichment kit according to manufacturer’s protocol (StemCell). Gene silencing. Transfections. Viral transduction. HIV-1 virus production and infection. Western blotting. FISH-flow. Confocal microscopy following FISH-flow. RT-qPCR. All experiments were performed in triplicate, and the data are presented as the mean ± standard deviation (SD). A p value of < 0.05 in a student’s t-test, one-way or two-way ANOVA test was considered statistically significant. GraphPad Prism 6 (Graphpad Software Inc.) was used to conduct statistical analyses and create graphs.
09bd6789-94c4-4c61-bb09-f810f3b3b5022979221629792216TatproteinCDK2proteinunknown293T cells were purchased from ATCC (Manassas, VA). Anti-FLAG monoclonal antibodies were purchased from Sigma (St. Louis, MO) and protein A/G agarose beads from Santa Cruz Biotechnology (Santa Cruz, CA). Recombinant CDK9/cyclin T1 and CDK2/cyclin E were purchased from ProQinase (Freiburg, Germany). GST-tagged truncated recombinant human PKR (EIF2AK2, amino acids 252–551) was purchased from Thermo Fisher (Waltham, MA). Double-stranded RNA (polyinosinic-polycytidylic acid) was purchased from Sigma (St. Louis, MO). Horseradish peroxidase (HRP)-conjugated F(ab)2 fragment was purchased from GE Healthcare (Piscataway, NJ). All other inorganic reagents were purchased from Fisher Scientific (Fair Lawn, NJ) or Sigma. Radioactive materials were purchased from Perkin-Elmer (Waltham MA).Knockdown of PKR and CDK2. HIV-1 infection assays. p24 ELISA. Biotinylated WT TAR RNA (59 nt) and mutant TAR RNA with the deletions of stem-loop nucleotides 21–27 and 38–41 were synthesized by Integrated DNA Technologies (Coralville, Iowa). Tat Mutagenesis in pNL4-3.Luc.R-E- and pCMV Link 1 Flag-Tat vectors. 293T cells were seeded in 6-well plates to achieve 50% confluence at the day of transfection. Immunoprecipitations. Phosphorylation of Tat-derived peptides in vitro. Hunter phosphopeptide mapping. HIV-1 Tat phosphorylation in vivo. Mass spectrometry. Flow cytometry. Analysis of Tat–TAR RNA interaction. Analysis of Tat ubiquitination. Building a homology model of CDK9/Cyclin T1/Tat complex. MD simulations were performed using the double precision version of AMBER 12 (University of California, San Francisco), the widely used software package for molecular and dynamic modeling of proteins running on the multiprocessor clusters of National Research Centre “Kurchatov Institute”.
e427e713-93ac-4273-aa35-2fc81cbb07b32979221629792216TatproteinDNA-PKproteinunknown293T cells were purchased from ATCC (Manassas, VA). Anti-FLAG monoclonal antibodies were purchased from Sigma (St. Louis, MO) and protein A/G agarose beads from Santa Cruz Biotechnology (Santa Cruz, CA). Recombinant CDK9/cyclin T1 and CDK2/cyclin E were purchased from ProQinase (Freiburg, Germany). GST-tagged truncated recombinant human PKR (EIF2AK2, amino acids 252–551) was purchased from Thermo Fisher (Waltham, MA). Double-stranded RNA (polyinosinic-polycytidylic acid) was purchased from Sigma (St. Louis, MO). Horseradish peroxidase (HRP)-conjugated F(ab)2 fragment was purchased from GE Healthcare (Piscataway, NJ). All other inorganic reagents were purchased from Fisher Scientific (Fair Lawn, NJ) or Sigma. Radioactive materials were purchased from Perkin-Elmer (Waltham MA).Knockdown of PKR and CDK2. HIV-1 infection assays. p24 ELISA. Biotinylated WT TAR RNA (59 nt) and mutant TAR RNA with the deletions of stem-loop nucleotides 21–27 and 38–41 were synthesized by Integrated DNA Technologies (Coralville, Iowa). Tat Mutagenesis in pNL4-3.Luc.R-E- and pCMV Link 1 Flag-Tat vectors. 293T cells were seeded in 6-well plates to achieve 50% confluence at the day of transfection. Immunoprecipitations. Phosphorylation of Tat-derived peptides in vitro. Hunter phosphopeptide mapping. HIV-1 Tat phosphorylation in vivo. Mass spectrometry. Flow cytometry. Analysis of Tat–TAR RNA interaction. Analysis of Tat ubiquitination. Building a homology model of CDK9/Cyclin T1/Tat complex. MD simulations were performed using the double precision version of AMBER 12 (University of California, San Francisco), the widely used software package for molecular and dynamic modeling of proteins running on the multiprocessor clusters of National Research Centre “Kurchatov Institute”.
f7a5cf19-cda9-4d6a-bdd2-d55cdba17d5f2979221629792216TatproteinPKRproteinunknown293T cells were purchased from ATCC (Manassas, VA). Anti-FLAG monoclonal antibodies were purchased from Sigma (St. Louis, MO) and protein A/G agarose beads from Santa Cruz Biotechnology (Santa Cruz, CA). Recombinant CDK9/cyclin T1 and CDK2/cyclin E were purchased from ProQinase (Freiburg, Germany). GST-tagged truncated recombinant human PKR (EIF2AK2, amino acids 252–551) was purchased from Thermo Fisher (Waltham, MA). Double-stranded RNA (polyinosinic-polycytidylic acid) was purchased from Sigma (St. Louis, MO). Horseradish peroxidase (HRP)-conjugated F(ab)2 fragment was purchased from GE Healthcare (Piscataway, NJ). All other inorganic reagents were purchased from Fisher Scientific (Fair Lawn, NJ) or Sigma. Radioactive materials were purchased from Perkin-Elmer (Waltham MA).Knockdown of PKR and CDK2. HIV-1 infection assays. p24 ELISA. Biotinylated WT TAR RNA (59 nt) and mutant TAR RNA with the deletions of stem-loop nucleotides 21–27 and 38–41 were synthesized by Integrated DNA Technologies (Coralville, Iowa). Tat Mutagenesis in pNL4-3.Luc.R-E- and pCMV Link 1 Flag-Tat vectors. 293T cells were seeded in 6-well plates to achieve 50% confluence at the day of transfection. Immunoprecipitations. Phosphorylation of Tat-derived peptides in vitro. Hunter phosphopeptide mapping. HIV-1 Tat phosphorylation in vivo. Mass spectrometry. Flow cytometry. Analysis of Tat–TAR RNA interaction. Analysis of Tat ubiquitination. Building a homology model of CDK9/Cyclin T1/Tat complex. MD simulations were performed using the double precision version of AMBER 12 (University of California, San Francisco), the widely used software package for molecular and dynamic modeling of proteins running on the multiprocessor clusters of National Research Centre “Kurchatov Institute”.
7bd0f733-07be-4e4c-b8c8-a5f6506778cc2979221629792216cyclin T1proteinTatproteinunknown293T cells were purchased from ATCC (Manassas, VA). Anti-FLAG monoclonal antibodies were purchased from Sigma (St. Louis, MO) and protein A/G agarose beads from Santa Cruz Biotechnology (Santa Cruz, CA). Recombinant CDK9/cyclin T1 and CDK2/cyclin E were purchased from ProQinase (Freiburg, Germany). GST-tagged truncated recombinant human PKR (EIF2AK2, amino acids 252–551) was purchased from Thermo Fisher (Waltham, MA). Double-stranded RNA (polyinosinic-polycytidylic acid) was purchased from Sigma (St. Louis, MO). Horseradish peroxidase (HRP)-conjugated F(ab)2 fragment was purchased from GE Healthcare (Piscataway, NJ). All other inorganic reagents were purchased from Fisher Scientific (Fair Lawn, NJ) or Sigma. Radioactive materials were purchased from Perkin-Elmer (Waltham MA).Knockdown of PKR and CDK2. HIV-1 infection assays. p24 ELISA. Biotinylated WT TAR RNA (59 nt) and mutant TAR RNA with the deletions of stem-loop nucleotides 21–27 and 38–41 were synthesized by Integrated DNA Technologies (Coralville, Iowa). Tat Mutagenesis in pNL4-3.Luc.R-E- and pCMV Link 1 Flag-Tat vectors. 293T cells were seeded in 6-well plates to achieve 50% confluence at the day of transfection. Immunoprecipitations. Phosphorylation of Tat-derived peptides in vitro. Hunter phosphopeptide mapping. HIV-1 Tat phosphorylation in vivo. Mass spectrometry. Flow cytometry. Analysis of Tat–TAR RNA interaction. Analysis of Tat ubiquitination. Building a homology model of CDK9/Cyclin T1/Tat complex. MD simulations were performed using the double precision version of AMBER 12 (University of California, San Francisco), the widely used software package for molecular and dynamic modeling of proteins running on the multiprocessor clusters of National Research Centre “Kurchatov Institute”.
b7742a98-77ce-46a1-a0ca-dd5808349ae72979221629792216TatproteinCDK9proteinunknown293T cells were purchased from ATCC (Manassas, VA). Anti-FLAG monoclonal antibodies were purchased from Sigma (St. Louis, MO) and protein A/G agarose beads from Santa Cruz Biotechnology (Santa Cruz, CA). Recombinant CDK9/cyclin T1 and CDK2/cyclin E were purchased from ProQinase (Freiburg, Germany). GST-tagged truncated recombinant human PKR (EIF2AK2, amino acids 252–551) was purchased from Thermo Fisher (Waltham, MA). Double-stranded RNA (polyinosinic-polycytidylic acid) was purchased from Sigma (St. Louis, MO). Horseradish peroxidase (HRP)-conjugated F(ab)2 fragment was purchased from GE Healthcare (Piscataway, NJ). All other inorganic reagents were purchased from Fisher Scientific (Fair Lawn, NJ) or Sigma. Radioactive materials were purchased from Perkin-Elmer (Waltham MA).Knockdown of PKR and CDK2. HIV-1 infection assays. p24 ELISA. Biotinylated WT TAR RNA (59 nt) and mutant TAR RNA with the deletions of stem-loop nucleotides 21–27 and 38–41 were synthesized by Integrated DNA Technologies (Coralville, Iowa). Tat Mutagenesis in pNL4-3.Luc.R-E- and pCMV Link 1 Flag-Tat vectors. 293T cells were seeded in 6-well plates to achieve 50% confluence at the day of transfection. Immunoprecipitations. Phosphorylation of Tat-derived peptides in vitro. Hunter phosphopeptide mapping. HIV-1 Tat phosphorylation in vivo. Mass spectrometry. Flow cytometry. Analysis of Tat–TAR RNA interaction. Analysis of Tat ubiquitination. Building a homology model of CDK9/Cyclin T1/Tat complex. MD simulations were performed using the double precision version of AMBER 12 (University of California, San Francisco), the widely used software package for molecular and dynamic modeling of proteins running on the multiprocessor clusters of National Research Centre “Kurchatov Institute”.
190aa873-4dd4-47ac-a2a8-f1cc21a94af02979221629792216cyclin T1proteinCDK9proteinunknown293T cells were purchased from ATCC (Manassas, VA). Anti-FLAG monoclonal antibodies were purchased from Sigma (St. Louis, MO) and protein A/G agarose beads from Santa Cruz Biotechnology (Santa Cruz, CA). Recombinant CDK9/cyclin T1 and CDK2/cyclin E were purchased from ProQinase (Freiburg, Germany). GST-tagged truncated recombinant human PKR (EIF2AK2, amino acids 252–551) was purchased from Thermo Fisher (Waltham, MA). Double-stranded RNA (polyinosinic-polycytidylic acid) was purchased from Sigma (St. Louis, MO). Horseradish peroxidase (HRP)-conjugated F(ab)2 fragment was purchased from GE Healthcare (Piscataway, NJ). All other inorganic reagents were purchased from Fisher Scientific (Fair Lawn, NJ) or Sigma. Radioactive materials were purchased from Perkin-Elmer (Waltham MA).Knockdown of PKR and CDK2. HIV-1 infection assays. p24 ELISA. Biotinylated WT TAR RNA (59 nt) and mutant TAR RNA with the deletions of stem-loop nucleotides 21–27 and 38–41 were synthesized by Integrated DNA Technologies (Coralville, Iowa). Tat Mutagenesis in pNL4-3.Luc.R-E- and pCMV Link 1 Flag-Tat vectors. 293T cells were seeded in 6-well plates to achieve 50% confluence at the day of transfection. Immunoprecipitations. Phosphorylation of Tat-derived peptides in vitro. Hunter phosphopeptide mapping. HIV-1 Tat phosphorylation in vivo. Mass spectrometry. Flow cytometry. Analysis of Tat–TAR RNA interaction. Analysis of Tat ubiquitination. Building a homology model of CDK9/Cyclin T1/Tat complex. MD simulations were performed using the double precision version of AMBER 12 (University of California, San Francisco), the widely used software package for molecular and dynamic modeling of proteins running on the multiprocessor clusters of National Research Centre “Kurchatov Institute”.
42b1cf0f-88c9-468a-ac5d-43027b2398462988752429887524RNA polymerase IIproteinSAFB1proteinunknownlentivirus vectors containing SAFB1-specific short hairpin RNAs (shRNAs)shRNAs were used to transduce Jurkat T or HEK293T cells to stably knock down SAFB1 expression, and then cells were further infected with a single-cycle infectious HIV-luc/VSV-G virus for 2 days
0a5661d3-97a1-4184-90d8-0b4b899616743094877230948772CD4proteinTrx1proteinunknownBiotin-maleimide, colchicine, DTNB (5,5′-Dithiobis(2-nitrobenzoic acid)), insulin, NADPH, paclitaxel (taxol), PDI, p-nitrophenyl phosphate and PX-12 were purchased from Sigma-Aldrich (Stockholm, Sweden). Recombinant HIV-1(IIIB) glycoprotein gp120 (CHO) was purchased from Immuno Diagnostics, Inc. (Woburn, MA) and Trx1,TrxR1 and the FkGRX-01 kit for Grx1 assay were from IMCO Corporation (Stockholm, Sweden). The compounds 6-(butyltelluro)-6-deoxy-β-cyclodextrin (TE-2), bis[4-(N,N-di(2-carbomethoxyethyl)amino)phenyl]telluride (TE-10), N,N-dimethyl-4-aminophenyl 3-phenoxypropyl telluride (TE-14) and 3-(butyltelluro)propanesulfonic acid sodium salt (TE-20) were synthesised dissolved in dimethylsulfoxide (DMSO) at 25 mM and kept at −20 °C until use. The monoclonal anti-acetylated tubulin antibody (catalogue # T7451, clone 6-11B-1, Batch # 036M4856V 1.1 mg/ml) and anti-β-actin (catalogue # A5441, clone AC-15) were both from Sigma-Aldrich (St. Louis, MO). TZM-bl cells were obtained through the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH, from Dr. John C. Kappes, Dr. Xiaoyun Wu and Tranzyme Inc. and the persistently HIV-1 infected ACH-2 cells were obtained from Dr. Thomas Folks1 × 104 TZM-bl cells/well were seeded in 100 µl complete DMEM medium in a 96 well plate (Nunc). 24 hours later the cells were washed twice with serum-free DMEM medium and then exposed to 0, 0.1 µM, 1 µM or 10 µM PX-12 diluted in serum-free DMEM medium for 1 hour. Negative control cells (0 µM PX-12) were added 0.5% (v/v) DMSO, the same concentration of DMSO used in the highest concentration of PX-12. Subsequently, virus suspension was added to all wells, except wells kept as non-infected controls. The cells were then further incubated for 2.5 hours at 37 °C and 5% CO2 before the cells were washed twice and the medium replaced with complete medium. After 48 hours incubation the supernatants were collected for p24 measurements and luminescence was assayed and quantified in a Luminoskan Ascent (Thermo Labsystems, Schwerte, Germany) for luciferase activity using the OneGlo luciferase assay system (Promega, Nacka, Sweden). The HIV p24 content was measured in an Architect i2000SR (Abbott Laboratories, IL). The data is based on four separate experiments. Infection in the absence of PX-12 is set to 100% and the values are presented as mean ± SEM. Two tailed student’s t-test was used to test for statistical significance.
ba658fbc-cbad-4ea8-899a-c8fbc5e96d503094877230948772Trx1proteingp120proteinunknownBiotin-maleimide, colchicine, DTNB (5,5′-Dithiobis(2-nitrobenzoic acid)), insulin, NADPH, paclitaxel (taxol), PDI, p-nitrophenyl phosphate and PX-12 were purchased from Sigma-Aldrich (Stockholm, Sweden). Recombinant HIV-1(IIIB) glycoprotein gp120 (CHO) was purchased from Immuno Diagnostics, Inc. (Woburn, MA) and Trx1,TrxR1 and the FkGRX-01 kit for Grx1 assay were from IMCO Corporation (Stockholm, Sweden). The compounds 6-(butyltelluro)-6-deoxy-β-cyclodextrin (TE-2), bis[4-(N,N-di(2-carbomethoxyethyl)amino)phenyl]telluride (TE-10), N,N-dimethyl-4-aminophenyl 3-phenoxypropyl telluride (TE-14) and 3-(butyltelluro)propanesulfonic acid sodium salt (TE-20) were synthesised dissolved in dimethylsulfoxide (DMSO) at 25 mM and kept at −20 °C until use. The monoclonal anti-acetylated tubulin antibody (catalogue # T7451, clone 6-11B-1, Batch # 036M4856V 1.1 mg/ml) and anti-β-actin (catalogue # A5441, clone AC-15) were both from Sigma-Aldrich (St. Louis, MO). TZM-bl cells were obtained through the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH, from Dr. John C. Kappes, Dr. Xiaoyun Wu and Tranzyme Inc. and the persistently HIV-1 infected ACH-2 cells were obtained from Dr. Thomas Folks96-well Maxi-Sorp ELISA plates (Nunc Inc, Roskilde, Denmark) were coated with 100 µl gp120 in 50 mM carbonate buffer pH 9.6 (2 µg/ml) over night at 4 °C and then blocked with PBS-T (phosphate buffered saline, pH 7.4 with 0.05% Tween 20) for 1 h at 37 °C. The experiment was performed with reaction mixtures containing 1 µM Trx1 + 100 nM TrxR1 + 240 µM NADPH + indicated concentrations of PX-12 (0–100 µM), 5 mM dithiothreitol was used as positive control and PBS as a negative control. The reaction mixtures were added to the gp120-coated wells for 30 min at 37 °C and then washed four times with PBS-T to remove any unbound material. Subsequently, the wells were incubated with 10 µM biotin-maleimide for 30 min at room temperature, then washed and incubated with steptavidine-ALP (Mabtech, Nacka, Sweden) diluted 1:1,000 in PBS for 30 min at room temperature. The wells were washed four times with PBS-T and 1 mg/ml p-nitrophenyl phosphate dissolved in 10% diethanolamine pH 9.8 with 0.5 mM MgCl2 was added. The absorbance at 405 nm was measured using a microplate reader (Tecan).The data is based on three separate experiments.
c57d8d03-501c-4de5-9f85-0c7d4b8b39f63094877230948772CD4proteingp120proteinunknownBiotin-maleimide, colchicine, DTNB (5,5′-Dithiobis(2-nitrobenzoic acid)), insulin, NADPH, paclitaxel (taxol), PDI, p-nitrophenyl phosphate and PX-12 were purchased from Sigma-Aldrich (Stockholm, Sweden). Recombinant HIV-1(IIIB) glycoprotein gp120 (CHO) was purchased from Immuno Diagnostics, Inc. (Woburn, MA) and Trx1,TrxR1 and the FkGRX-01 kit for Grx1 assay were from IMCO Corporation (Stockholm, Sweden). The compounds 6-(butyltelluro)-6-deoxy-β-cyclodextrin (TE-2), bis[4-(N,N-di(2-carbomethoxyethyl)amino)phenyl]telluride (TE-10), N,N-dimethyl-4-aminophenyl 3-phenoxypropyl telluride (TE-14) and 3-(butyltelluro)propanesulfonic acid sodium salt (TE-20) were synthesised dissolved in dimethylsulfoxide (DMSO) at 25 mM and kept at −20 °C until use. The monoclonal anti-acetylated tubulin antibody (catalogue # T7451, clone 6-11B-1, Batch # 036M4856V 1.1 mg/ml) and anti-β-actin (catalogue # A5441, clone AC-15) were both from Sigma-Aldrich (St. Louis, MO). TZM-bl cells were obtained through the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH, from Dr. John C. Kappes, Dr. Xiaoyun Wu and Tranzyme Inc. and the persistently HIV-1 infected ACH-2 cells were obtained from Dr. Thomas Folks96-well Maxi-Sorp ELISA plates (Nunc Inc, Roskilde, Denmark) were coated with 100 µl gp120 in 50 mM carbonate buffer pH 9.6 (2 µg/ml) over night at 4 °C and then blocked with PBS-T (phosphate buffered saline, pH 7.4 with 0.05% Tween 20) for 1 h at 37 °C. The experiment was performed with reaction mixtures containing 1 µM Trx1 + 100 nM TrxR1 + 240 µM NADPH + indicated concentrations of PX-12 (0–100 µM), 5 mM dithiothreitol was used as positive control and PBS as a negative control. The reaction mixtures were added to the gp120-coated wells for 30 min at 37 °C and then washed four times with PBS-T to remove any unbound material. Subsequently, the wells were incubated with 10 µM biotin-maleimide for 30 min at room temperature, then washed and incubated with steptavidine-ALP (Mabtech, Nacka, Sweden) diluted 1:1,000 in PBS for 30 min at room temperature. The wells were washed four times with PBS-T and 1 mg/ml p-nitrophenyl phosphate dissolved in 10% diethanolamine pH 9.8 with 0.5 mM MgCl2 was added. The absorbance at 405 nm was measured using a microplate reader (Tecan).The data is based on three separate experiments.
cad221e8-4819-4f1b-b9d8-335becfca03a3095926430959264MxBproteinSAMHD1proteinunknownHEK293T cells were grown in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% (vol/vol) fetal bovine serum and 1% (vol/vol) penicillin-streptomycin. Human THP-1 cells (ATCC TIB-202) were grown in RPMI medium supplemented with 10% (vol/vol) fetal bovine serum and 1% (vol/vol) penicillin-streptomycin. Human monocyte derived macrophages (MDMs) were prepared from peripheral blood mononuclear cells (PBMCs). PBMCs were isolated using Ficoll-Paque Plus (GE Health Care) separation from healthy donors. Monocytes were obtained via negative selection using a Monocyte Isolation Kit II human (MACS Miltenyi Biotec) and differentiated into MDMs by treatment with granulocyte-macrophages colony stimulating factor (GM-CSF) (10 ng/mL, Miltenyl Biotec) for 7 days.The CA-NC proteins of HIV-1 and HIV-1 bearing the G208R capsid mutant (HIV-1-G208R) were expressed, purified, and assembled. Generation of MxB and SAMDH1 knockout human cells. Generation of MxB knockdown primary macrophages. Infection using GFP-reporter viruses. Co-immunoprecipitation assay. EGS cross-linking with co-immunoprecipitation experiments of MxB variants. Binding to HIV-1 CA-NC complexes pre-assembled in vitro. Western blot analysis. Quantification of cellular dNTPs by primer extension assay.
c0e98fd0-3ca1-4a43-af08-91a4205623003120920431209204ATG5proteinBAG3proteinunknownTat transgenic mice Doxycycline (DOX)-inducible GFAP promoter driven HIV-1 Tat transgenic mice were provided by the Comprehensive NeuroAIDS Center. Adult mice (18–28 g) were singly housed in a temperature (21–23°) and humidity-controlled vivarium with constant airflow on a reverse 12-h light/dark cycle (lights off at 09:00). Food and water were available ad libitum. Mice expressed the HIV-1 tat transgene (TAT) or their control littermates. Briefly, TAT mice conditionally-expressed the HIV-1 Tat1–86 protein in an astrocyte-specific manner under the control of a GFAP-driven Tet-on promoter which is activated in the presence of DOX. TAT mice received an 80 mg/kg intraperitoneal (i.p.) injection of doxycycline hyclate (DOX). After this 14-day period, all mice were euthanized and prepared for harvest of brain tissue for western analyses.Neuronal and mouse brain tissue lysates were prepared using RIPA lysis buffer (whole cell extract), Tris-Triton (soluble fraction) or 2% SDS in PBS (insoluble fraction), all containing protease inhibitor cocktail (Sigma–Aldrich, St. Louis, MO). Intracellular Tat was probed in Ad-Tat transduced neurons through immunocytochemistry. Brain tissue samples of wild type and Tg26 transgenic mice were collected and frozen tissue sectioning was embedded based on standard protocol. RNA isolation and cDNA preparation. Real-time quantitative RT-PCR (qRT-PCR). Microelectrode arrays (MEAs) were used to perform electrophysiological recordings at 2 kHz on an MEA60 system (Multichannel systems, Germany) from hippocampal neurons undergoing control, BAG3 KD, BAG3 overexpression, and Tat expression starting from 25 DIV.
c508fc95-eec7-41b1-889d-dc29528adffe3120920431209204LC3-IIproteinBAG3proteinunknownTat transgenic mice Doxycycline (DOX)-inducible GFAP promoter driven HIV-1 Tat transgenic mice were provided by the Comprehensive NeuroAIDS Center. Adult mice (18–28 g) were singly housed in a temperature (21–23°) and humidity-controlled vivarium with constant airflow on a reverse 12-h light/dark cycle (lights off at 09:00). Food and water were available ad libitum. Mice expressed the HIV-1 tat transgene (TAT) or their control littermates. Briefly, TAT mice conditionally-expressed the HIV-1 Tat1–86 protein in an astrocyte-specific manner under the control of a GFAP-driven Tet-on promoter which is activated in the presence of DOX. TAT mice received an 80 mg/kg intraperitoneal (i.p.) injection of doxycycline hyclate (DOX). After this 14-day period, all mice were euthanized and prepared for harvest of brain tissue for western analyses.Neuronal and mouse brain tissue lysates were prepared using RIPA lysis buffer (whole cell extract), Tris-Triton (soluble fraction) or 2% SDS in PBS (insoluble fraction), all containing protease inhibitor cocktail (Sigma–Aldrich, St. Louis, MO). Intracellular Tat was probed in Ad-Tat transduced neurons through immunocytochemistry. Brain tissue samples of wild type and Tg26 transgenic mice were collected and frozen tissue sectioning was embedded based on standard protocol. RNA isolation and cDNA preparation. Real-time quantitative RT-PCR (qRT-PCR). Microelectrode arrays (MEAs) were used to perform electrophysiological recordings at 2 kHz on an MEA60 system (Multichannel systems, Germany) from hippocampal neurons undergoing control, BAG3 KD, BAG3 overexpression, and Tat expression starting from 25 DIV.
bbffad6e-37cf-46b2-b184-c486ae7b501e3120920431209204LC3-IproteinBAG3proteinunknownTat transgenic mice Doxycycline (DOX)-inducible GFAP promoter driven HIV-1 Tat transgenic mice were provided by the Comprehensive NeuroAIDS Center. Adult mice (18–28 g) were singly housed in a temperature (21–23°) and humidity-controlled vivarium with constant airflow on a reverse 12-h light/dark cycle (lights off at 09:00). Food and water were available ad libitum. Mice expressed the HIV-1 tat transgene (TAT) or their control littermates. Briefly, TAT mice conditionally-expressed the HIV-1 Tat1–86 protein in an astrocyte-specific manner under the control of a GFAP-driven Tet-on promoter which is activated in the presence of DOX. TAT mice received an 80 mg/kg intraperitoneal (i.p.) injection of doxycycline hyclate (DOX). After this 14-day period, all mice were euthanized and prepared for harvest of brain tissue for western analyses.Neuronal and mouse brain tissue lysates were prepared using RIPA lysis buffer (whole cell extract), Tris-Triton (soluble fraction) or 2% SDS in PBS (insoluble fraction), all containing protease inhibitor cocktail (Sigma–Aldrich, St. Louis, MO). Intracellular Tat was probed in Ad-Tat transduced neurons through immunocytochemistry. Brain tissue samples of wild type and Tg26 transgenic mice were collected and frozen tissue sectioning was embedded based on standard protocol. RNA isolation and cDNA preparation. Real-time quantitative RT-PCR (qRT-PCR). Microelectrode arrays (MEAs) were used to perform electrophysiological recordings at 2 kHz on an MEA60 system (Multichannel systems, Germany) from hippocampal neurons undergoing control, BAG3 KD, BAG3 overexpression, and Tat expression starting from 25 DIV.
1adfd4b3-074f-41ca-afc2-1ae1879f58223120920431209204synaptotagmin 1proteinBAG3proteinunknownTat transgenic mice Doxycycline (DOX)-inducible GFAP promoter driven HIV-1 Tat transgenic mice were provided by the Comprehensive NeuroAIDS Center. Adult mice (18–28 g) were singly housed in a temperature (21–23°) and humidity-controlled vivarium with constant airflow on a reverse 12-h light/dark cycle (lights off at 09:00). Food and water were available ad libitum. Mice expressed the HIV-1 tat transgene (TAT) or their control littermates. Briefly, TAT mice conditionally-expressed the HIV-1 Tat1–86 protein in an astrocyte-specific manner under the control of a GFAP-driven Tet-on promoter which is activated in the presence of DOX. TAT mice received an 80 mg/kg intraperitoneal (i.p.) injection of doxycycline hyclate (DOX). After this 14-day period, all mice were euthanized and prepared for harvest of brain tissue for western analyses.Neuronal and mouse brain tissue lysates were prepared using RIPA lysis buffer (whole cell extract), Tris-Triton (soluble fraction) or 2% SDS in PBS (insoluble fraction), all containing protease inhibitor cocktail (Sigma–Aldrich, St. Louis, MO). Intracellular Tat was probed in Ad-Tat transduced neurons through immunocytochemistry. Brain tissue samples of wild type and Tg26 transgenic mice were collected and frozen tissue sectioning was embedded based on standard protocol. RNA isolation and cDNA preparation. Real-time quantitative RT-PCR (qRT-PCR). Microelectrode arrays (MEAs) were used to perform electrophysiological recordings at 2 kHz on an MEA60 system (Multichannel systems, Germany) from hippocampal neurons undergoing control, BAG3 KD, BAG3 overexpression, and Tat expression starting from 25 DIV.
b64cebe0-6b47-4580-bab5-d55fac340a2d3120920431209204synaptotagmin 1proteinBAG3proteinunknownTat transgenic mice Doxycycline (DOX)-inducible GFAP promoter driven HIV-1 Tat transgenic mice were provided by the Comprehensive NeuroAIDS Center. Adult mice (18–28 g) were singly housed in a temperature (21–23°) and humidity-controlled vivarium with constant airflow on a reverse 12-h light/dark cycle (lights off at 09:00). Food and water were available ad libitum. Mice expressed the HIV-1 tat transgene (TAT) or their control littermates. Briefly, TAT mice conditionally-expressed the HIV-1 Tat1–86 protein in an astrocyte-specific manner under the control of a GFAP-driven Tet-on promoter which is activated in the presence of DOX. TAT mice received an 80 mg/kg intraperitoneal (i.p.) injection of doxycycline hyclate (DOX). After this 14-day period, all mice were euthanized and prepared for harvest of brain tissue for western analyses.Neuronal and mouse brain tissue lysates were prepared using RIPA lysis buffer (whole cell extract), Tris-Triton (soluble fraction) or 2% SDS in PBS (insoluble fraction), all containing protease inhibitor cocktail (Sigma–Aldrich, St. Louis, MO). Intracellular Tat was probed in Ad-Tat transduced neurons through immunocytochemistry. Brain tissue samples of wild type and Tg26 transgenic mice were collected and frozen tissue sectioning was embedded based on standard protocol. RNA isolation and cDNA preparation. Real-time quantitative RT-PCR (qRT-PCR). Microelectrode arrays (MEAs) were used to perform electrophysiological recordings at 2 kHz on an MEA60 system (Multichannel systems, Germany) from hippocampal neurons undergoing control, BAG3 KD, BAG3 overexpression, and Tat expression starting from 25 DIV.
2644debd-20b1-4ceb-9330-b2872488720c3120920431209204TatproteinBAG3proteinunknownTat transgenic mice Doxycycline (DOX)-inducible GFAP promoter driven HIV-1 Tat transgenic mice were provided by the Comprehensive NeuroAIDS Center. Adult mice (18–28 g) were singly housed in a temperature (21–23°) and humidity-controlled vivarium with constant airflow on a reverse 12-h light/dark cycle (lights off at 09:00). Food and water were available ad libitum. Mice expressed the HIV-1 tat transgene (TAT) or their control littermates. Briefly, TAT mice conditionally-expressed the HIV-1 Tat1–86 protein in an astrocyte-specific manner under the control of a GFAP-driven Tet-on promoter which is activated in the presence of DOX. TAT mice received an 80 mg/kg intraperitoneal (i.p.) injection of doxycycline hyclate (DOX). After this 14-day period, all mice were euthanized and prepared for harvest of brain tissue for western analyses.Neuronal and mouse brain tissue lysates were prepared using RIPA lysis buffer (whole cell extract), Tris-Triton (soluble fraction) or 2% SDS in PBS (insoluble fraction), all containing protease inhibitor cocktail (Sigma–Aldrich, St. Louis, MO). Intracellular Tat was probed in Ad-Tat transduced neurons through immunocytochemistry. Brain tissue samples of wild type and Tg26 transgenic mice were collected and frozen tissue sectioning was embedded based on standard protocol. RNA isolation and cDNA preparation. Real-time quantitative RT-PCR (qRT-PCR). Microelectrode arrays (MEAs) were used to perform electrophysiological recordings at 2 kHz on an MEA60 system (Multichannel systems, Germany) from hippocampal neurons undergoing control, BAG3 KD, BAG3 overexpression, and Tat expression starting from 25 DIV.
619b0711-cdc6-494d-8132-28b70ead4d5a3151161531511615VprproteinCTIP2proteinunknownJurkat T-cells and microglial cellsTo confirm that the depletion of CTIP2 mediated by Vpr occurs at a post-transcriptional step, we next overexpressed a FLAG tagged CTIP2 in the presence of normalized quantities of WT and ΔVpr proviruses
0e2547a1-8756-4f55-9002-7dabca6378643103602731036027integraseproteinPSFproteinunknownAll materials were purchased from sigma if not indicated otherwise. Antibody against IN was purchased from Santa cruz, sc-69721, anti-PSF (P2860) and anti-His (SAB1305538-40TST) antibody purchased from Sigma, horseradish peroxidase (HRP) conjugated goat anti-mouse secondary antibody was purchased from Santa cruz-sc2005.Protein binding assay. Co-immunoprecipitation (co-IP) and western blot. In vitro direct physical interaction between the two proteins was identified by using purified proteins. To confirm the interaction, both his tagged proteins were purified by Ni+2–NTA affinity chromatography after DNAse treatment. HeLa and HEK 293T cell line were seeded on a cover slip in six well plate and transfected with GFP-PSF plasmid and monomeric Red Fluorescent protein tagged IN (mRFP-IN) in 1:1 ratio (800 ng) using lipofectamine 2000 (Invitrogen) in a serum free antibiotic free medium. Cell viability assay. The cloning of PSF in bacterial expression vector pPROEX-HTC was done using GFP-PSF as a template. The wild type protein is purified from Ni to NTA Sepharose column chromatography. The 3′P assay was performed with 21 mer oligos 5′ATGTGGAAAATCTCTAGCAGT 3′, 5′ACTGCT AGAGATTTTCCACAT 3′. Transient knockdown of PSF - The pool of siRNA (Sigma) was used to knockdown human PSF. Virus production and transduction in knockdown cells. Quantitative real time PCR assay. Infectivity assay of viral particles after PSF knockdown. The data for luciferase assay and qPCR were analysed using paired t test that yielded two tail P value (GraphPad PRISM 7).
68862730-3988-4dbb-8b5d-349ad693d70a3097408530974085EnvproteinCD4proteinunknownsmFRET imaging on HIV-1JR-FL Env and Env ΔCT with donor and acceptor fluorophores attached to the V1 and V4 loops of gp120Using a combination of smFRET imaging, antibody-binding and ADCC assays, and cryoelectron microscopy (cryo-EM)
813e727b-2e74-46e9-997a-e7a2a8aaa4353161164131611641TRN-1proteinHIV-1 capsidproteinunknownThe primary antibodies used were: mouse monoclonals against β-actin, α-tubulin and FLAG (all from Sigma), p24 (NIH AIDS Reagent program clones 183-H12-5C and AG3.0), integrase (gift from M. Lavigne), TRN-3 (Abcam), lamin A/C (Leica Biosystems), and TRN-1, KPNB1, IPO5 and IPO7 (all from Santa Cruz); rabbit anti-p24 (NIH AIDS Reagent Program SF2), -cyclophilin A (Cell Signaling) and -Nup214 (Abcam); anti-HA from mouse (Sigma), rat (Roche) and rabbit (Abcam). The secondary antibodies were goat anti-mouse and rabbit (GE Healthcare) or anti-rat (Abcam) horseradish peroxidase conjugates, goat anti-mouse and -rabbit A488 and A647 (Life Technologies). Nuclei were stained with Hoechst dye (Invitrogen).Cell fractionation and LC–MS/MS analyses. Immunoprecipitation. Recombinant protein expression and purification. Assembly of CANC tubes. Surface plasmon resonance. Atomic force microscopy. Transmission electron microscopy. Fate-of-capsid assay. In vitro CA-uncoating assay. Molecular docking. Statistical analysis.
d5e1dd73-0845-4171-a0f3-dba8759be12f3162894831628948VifproteinA3Hproteinunknownmutants of A3H (D121K and E56A/W115A/R175E/R176E) within the same backbone were made by site-directed mutagenesis and verified by Sanger sequencing. The lentiviral Vif protein from HIV-1 IIIB (EU541617) was codon optimized (GenScript Corp) and cloned into pVR1012 with a C-terminal HA tag using SalI and BamHI. The Vif protein from HIV-1 LAI was cloned into pVR1012 with a C-terminal HA tag using SalI and NotI. F39V mutant of HIV-1 LAI Vif, Hypo-variant (F39V), N48H, and Hyper-variant (N48H, GDAK60-63EKGE) of HIV-1 IIIB Vif were made by site-directed mutagenesis and verified by Sanger sequencing.293T cells were transfected with WT or mutant pcDNA3.1(+)-A3H, along with 500 or 1000 ng pVR1012- HIV-1 LAI Vif WT/F39V-HA (Fig. 2a), or 50 or 100 ng pVR1012- HIV-1 IIIB Hyper-/Hypo-Vif (Fig. 2c) or empty vector, using Transit-LT1 (Mirus). Immunoblotting experiments - proteins were separated using discontinuous sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to polyvinylidene difluoride (PVDF) membranes (Millipore). HA-tagged A3 proteins were detected using monoclonal mouse anti-HA (BioLegend #MMS-101P). A3H proteins were detected using polyclonal rabbit anti-A3H (Novus #NBP1-91682). Tubulin was detected using a monoclonal mouse anti-α-Tubulin antibody (Covance #MMS-489P). Immunoblots were quantified using ImageStudio. Live cell fluorescent imaging. All amino acid sequences were aligned using Clustal Omega.
4904ca4e-1b4d-4da3-8f8b-51e7fbb919752168213921682139reverse transcriptaseproteinlaccaseproteinunknownmutants of A3H (D121K and E56A/W115A/R175E/R176E) within the same backbone were made by site-directed mutagenesis and verified by Sanger sequencing. The lentiviral Vif protein from HIV-1 IIIB (EU541617) was codon optimized (GenScript Corp) and cloned into pVR1012 with a C-terminal HA tag using SalI and BamHI. The Vif protein from HIV-1 LAI was cloned into pVR1012 with a C-terminal HA tag using SalI and NotI. F39V mutant of HIV-1 LAI Vif, Hypo-variant (F39V), N48H, and Hyper-variant (N48H, GDAK60-63EKGE) of HIV-1 IIIB Vif were made by site-directed mutagenesis and verified by Sanger sequencing.293T cells were transfected with WT or mutant pcDNA3.1(+)-A3H, along with 500 or 1000 ng pVR1012- HIV-1 LAI Vif WT/F39V-HA (Fig. 2a), or 50 or 100 ng pVR1012- HIV-1 IIIB Hyper-/Hypo-Vif (Fig. 2c) or empty vector, using Transit-LT1 (Mirus). Immunoblotting experiments - proteins were separated using discontinuous sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to polyvinylidene difluoride (PVDF) membranes (Millipore). HA-tagged A3 proteins were detected using monoclonal mouse anti-HA (BioLegend #MMS-101P). A3H proteins were detected using polyclonal rabbit anti-A3H (Novus #NBP1-91682). Tubulin was detected using a monoclonal mouse anti-α-Tubulin antibody (Covance #MMS-489P). Immunoblots were quantified using ImageStudio. Live cell fluorescent imaging. All amino acid sequences were aligned using Clustal Omega.
cd0f1458-790a-44fd-9c24-634305b563bb2201478622014786reverse transcriptaseproteincordysobinproteinunknownDried fruiting bodies of C. sobolifera mushrooms were collected in Anhui, China. DEAE-cellulose, Pepstatin A, EDTA, PMSF, LBTI, E-64, chymostatin, Elastatinal, casein sodium salt, Succinyl-Leu-Leu-Val-Tyr-4-methyl-coumaryl-7-amide (Suc-Leu-Leu-Val-Tyr-MCA) and other synthetic fluorogenic peptide substrates (MCAsubstrates) were obtained from Sigma. Trypsin was purchased from Promega. SPSepharose and Superdex 75 were from GE Healthcare. All other chemicals were of reagent grade.Purification of protease. Assay for proteolytic activity. The standard proteolytic activity against casein in protein purification was assayed according to the method of Satake et al. (46). Assay of the enzyme thermostability. Assay of enzyme kinetics. Effect of metal ions and enzyme inhibitors. The assay for HIV reverse transcriptase inhibitory activity was performed by using a nonradioactive ELISA kit from Boehringer-Mannheim (Germany) as described by Zhang et al. (5).
06a9f5b1-e206-45f4-b3b9-e932c9505a822251340622513406pol ОіproteinFLT-TPproteinunknowndTTP was purchased from GE Healthcare (Chalfont St. Giles, Buckinghamshire, UK). Triphosphate versions of FLT and Ed4T were prepared as described previously (Ray et al., 2002c). The DNA oligonucleotides D22 (5′-GCCTCGCAGCCGTCCAACCAAC-3′) and D45 (3′-CGGAGCGTCGGCAGGTTGGTTGAGTTGGAGCTAGGTTACGGCAGG-5′) were purchased from Integrated DNA Technologies, Inc. (Coralville, IA) and were purified on 20% polyacrylamide denaturing gels. T4 polynucleotide kinase (New England Biolabs, Ipswich, MA) was used to label the D22 oligonucleotide at the 5′ terminus with [γ-32P]ATP (PerkinElmer Life and Analytical Sciences, Waltham, MA). This D22 primer was then annealed to the D45 template, to generate the DNA primer/template substrate. Enzymes. The recombinant WT accessory subunit of pol γ was expressed and purified as described previously (Johnson et al., 2000). All pol γ catalytic subunits used contained an N-terminal hexa-histidine tag. The recombinant, exonuclease-deficient, WT catalytic subunit (i.e., WT pol γ) was expressed and purified as described previously (Graziewicz et al., 2004), with minor modifications in the strategy for chromatography. Specifically, WT pol γ was eluted from a nickel column by using a linear gradient of 20 to 400 mM imidazole. The recombinant exonuclease-competent pol γ catalytic subunit (exo+ pol γ) was expressed and purified as described previously (Longley et al., 1998; Lim et al., 2003; Kasiviswanathan et al., 2010). Site-directed mutagenesis was used to generate the R964C pol γ construct, and the recombinant protein was expressed and purified as detailed elsewhere (Kasiviswanathan et al., 2010).Single-Nucleotide Incorporation Assays. Single-nucleotide incorporation experiments were performed by using a KinTek RQF-3 rapid chemical quench apparatus (KinTek Corp., Austin, TX) operated at 37°C. To determine the active-site concentration of each of the enzymes used, dTTP incorporation into the D22/D45 primer/template substrate was examined under burst conditions, as described previously (Murakami et al., 2003). For incorporation by WT pol γ and R964C pol γ, 100 nM pol γ catalytic subunit (active-site concentration) was preincubated with an excess of pol γ accessory subunit (4-fold higher concentration than the total, non–active-site, concentration of the catalytic subunit). Excision Reactions.
c0dcc39d-8c60-4667-b95f-dbe0ef0da2073175785431757854EnvproteinGagproteinunknownMonovalent Fab anti-Env gp120 probes b12-QD605 and PGT145-QD605 were generated by recombinant bacterial expression and incorporation of a p-azido-l-phenylalanine unnatural amino acid (23, 26). Fab probes were conjugated to single fluorescent quantum dots (Thermo Fisher) using copper-free click chemistry (25, 27). Gag and Env were expressed from the HIV-1 NL4-3 reference genome via single-round infection of COS7 or CEM-A cells and imaged at 40 to 44 h postinfection. The p6 motif of Gag was mutated to remove the PTAP motif and ensure that virus assembly sites were cell associated. Gag was indirectly labeled by cytoplasmic expression of a capsid N-terminal domain-specific nanobody fused to the enhanced green fluorescent protein gene (CANTD-eGFP)CANTD-eGFP was expressed through the nef splice acceptor site in the NL4-3 genome. Surface-exposed Env was labeled with b12-QD605 or PGT145-QD605 probes and imaged under physiological conditions (37 °C and 5% CO2) using a custom-built total internal reflection fluorescence microscope. The fluorescence emission from both the eGFP and QD605 probes was split into 2 channels and simultaneously imaged onto 2 halves of an sCMOS camera operating at 100 Hz (Hamamatsu). Raw images were corrected for pixel nonuniformity, split into respective channels, and corrected for chromatic aberration using fiduciary reference. Image channels were separately processed using custom peak finding software (IDL; Harris Geospatial), and the resulting subpixel coordinates were segmented for individual regions of interest using custom Matlab code (Mathworks). Sparse QD605 localizations were linked to create particle trajectories using custom single-particle tracking analysis software written in Matlab.
6e31069a-15bf-42a5-b3fd-cdb772c2e06b3175918731759187p24proteinPACS1proteinunknownThe PACS1-HA plasmid was provided by Dr. Gary Thomas (University of Pittsburg). The PACS1-HA sequences were inserted into the MLV-based vector pBabe (provided by Dr. Richard Sutton, Yale University). The pCMVGagPol-RRE and pCMV-RevFlag plasmids were provided by Dr. Marie-Louise Hammarskjöld (University of Virginia). The Flag-Vpr plasmid was constructed by PCR amplification of the NL4-3 Vpr gene and insertion into a CMV-Flag expression plasmid. The influenza virus Flag-NS1 plasmid contains a mutation in the NS1 binding site to CPSF30 to increase NS1 protein expression (Golebiewski, Liu et al., 2011). The pHMRLuc (Renilla) and Rem-GFP (Green Fluorescent Protein) plasmids were provided by Dr. Jaquelin Dudley (University of Texas). PACS1 (sc-106348) and control (sc 37007) small interfering RNAs (siRNAs) were from Santa Cruz Biotechnology. PACS1 antiserum (ab56072) was from Abcam; anti-HA antibody was from Santa Cruz Biotechnology (sc-7392); anti-CRM1 antibody (ST1100) and Flag antibody (F1804) were from Millipore and Sigma-Aldrich.Transfections.
f18ac055-9dd6-4f9d-b635-f4cf44089c243175918731759187Furinproteingp160proteinunknownThe PACS1-HA plasmid was provided by Dr. Gary Thomas (University of Pittsburg). The PACS1-HA sequences were inserted into the MLV-based vector pBabe (provided by Dr. Richard Sutton, Yale University). The pCMVGagPol-RRE and pCMV-RevFlag plasmids were provided by Dr. Marie-Louise Hammarskjöld (University of Virginia). The Flag-Vpr plasmid was constructed by PCR amplification of the NL4-3 Vpr gene and insertion into a CMV-Flag expression plasmid. The influenza virus Flag-NS1 plasmid contains a mutation in the NS1 binding site to CPSF30 to increase NS1 protein expression (Golebiewski, Liu et al., 2011). The pHMRLuc (Renilla) and Rem-GFP (Green Fluorescent Protein) plasmids were provided by Dr. Jaquelin Dudley (University of Texas). PACS1 (sc-106348) and control (sc 37007) small interfering RNAs (siRNAs) were from Santa Cruz Biotechnology. PACS1 antiserum (ab56072) was from Abcam; anti-HA antibody was from Santa Cruz Biotechnology (sc-7392); anti-CRM1 antibody (ST1100) and Flag antibody (F1804) were from Millipore and Sigma-Aldrich.RNA isolation and RT-PCR. Immunoprecipitations and immunoblots. Flow cytometry. Polysome profiles.
fb39c34b-849a-4d6a-beeb-ddf304894f083175918731759187FurinproteinPACS1proteinunknownThe PACS1-HA plasmid was provided by Dr. Gary Thomas (University of Pittsburg). The PACS1-HA sequences were inserted into the MLV-based vector pBabe (provided by Dr. Richard Sutton, Yale University). The pCMVGagPol-RRE and pCMV-RevFlag plasmids were provided by Dr. Marie-Louise Hammarskjöld (University of Virginia). The Flag-Vpr plasmid was constructed by PCR amplification of the NL4-3 Vpr gene and insertion into a CMV-Flag expression plasmid. The influenza virus Flag-NS1 plasmid contains a mutation in the NS1 binding site to CPSF30 to increase NS1 protein expression (Golebiewski, Liu et al., 2011). The pHMRLuc (Renilla) and Rem-GFP (Green Fluorescent Protein) plasmids were provided by Dr. Jaquelin Dudley (University of Texas). PACS1 (sc-106348) and control (sc 37007) small interfering RNAs (siRNAs) were from Santa Cruz Biotechnology. PACS1 antiserum (ab56072) was from Abcam; anti-HA antibody was from Santa Cruz Biotechnology (sc-7392); anti-CRM1 antibody (ST1100) and Flag antibody (F1804) were from Millipore and Sigma-Aldrich.RNA isolation and RT-PCR. Immunoprecipitations and immunoblots. Flow cytometry. Polysome profiles.
65f94d25-7acd-43c4-a69f-ac3a25bf733a3175918731759187RevproteinPACS1proteinunknownThe PACS1-HA plasmid was provided by Dr. Gary Thomas (University of Pittsburg). The PACS1-HA sequences were inserted into the MLV-based vector pBabe (provided by Dr. Richard Sutton, Yale University). The pCMVGagPol-RRE and pCMV-RevFlag plasmids were provided by Dr. Marie-Louise Hammarskjöld (University of Virginia). The Flag-Vpr plasmid was constructed by PCR amplification of the NL4-3 Vpr gene and insertion into a CMV-Flag expression plasmid. The influenza virus Flag-NS1 plasmid contains a mutation in the NS1 binding site to CPSF30 to increase NS1 protein expression (Golebiewski, Liu et al., 2011). The pHMRLuc (Renilla) and Rem-GFP (Green Fluorescent Protein) plasmids were provided by Dr. Jaquelin Dudley (University of Texas). PACS1 (sc-106348) and control (sc 37007) small interfering RNAs (siRNAs) were from Santa Cruz Biotechnology. PACS1 antiserum (ab56072) was from Abcam; anti-HA antibody was from Santa Cruz Biotechnology (sc-7392); anti-CRM1 antibody (ST1100) and Flag antibody (F1804) were from Millipore and Sigma-Aldrich.RNA isolation and RT-PCR. Immunoprecipitations and immunoblots. Flow cytometry. Polysome profiles.
8377ffd7-f859-4837-96f2-1990dfa6d2533175918731759187CRM1proteinPACS1proteinunknownThe PACS1-HA plasmid was provided by Dr. Gary Thomas (University of Pittsburg). The PACS1-HA sequences were inserted into the MLV-based vector pBabe (provided by Dr. Richard Sutton, Yale University). The pCMVGagPol-RRE and pCMV-RevFlag plasmids were provided by Dr. Marie-Louise Hammarskjöld (University of Virginia). The Flag-Vpr plasmid was constructed by PCR amplification of the NL4-3 Vpr gene and insertion into a CMV-Flag expression plasmid. The influenza virus Flag-NS1 plasmid contains a mutation in the NS1 binding site to CPSF30 to increase NS1 protein expression (Golebiewski, Liu et al., 2011). The pHMRLuc (Renilla) and Rem-GFP (Green Fluorescent Protein) plasmids were provided by Dr. Jaquelin Dudley (University of Texas). PACS1 (sc-106348) and control (sc 37007) small interfering RNAs (siRNAs) were from Santa Cruz Biotechnology. PACS1 antiserum (ab56072) was from Abcam; anti-HA antibody was from Santa Cruz Biotechnology (sc-7392); anti-CRM1 antibody (ST1100) and Flag antibody (F1804) were from Millipore and Sigma-Aldrich.RNA isolation and RT-PCR. Immunoprecipitations and immunoblots. Flow cytometry. Polysome profiles.
414ddef8-665c-4c19-afb1-31bb1057ce0b3188808431888084integraseproteinHDAC10proteinunknownHDAC10 shRNA-1 (target: 5′-ATCCCATCTAAGAGGTACAGG-3′) and HDAC10 shRNA-2 (target: 5′-TGCGGTGTCATTTCTGCGGTG-3′) lentiviral plasmid and Scramble control plasmid (target: 5′-CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGG-3′) were purchased from Open Biosystem. HDAC6-FLAG expression plasmid was purchased from Addgene. HDAC10-Myc expression plasmid was purchased from Sino Biological Company. pFLAG-HDAC10 H135A was kindly provided by Dr. Li Y. The green fluorescent protein-integrase (GFP-IN) wild type fusion protein, GFP-IN mutants, and IN-YFP were described previously. Rabbit anti-GFP polyclonal antibody (purchased from Molecular Probes), rabbit anti-HDAC6 (purchased from Santa Cruz, CA, USA), anti-T7-HRP conjugated antibody (purchased from Novagen, WI, USA), mouse anti-Tubulin antibody (purchased from Sigma, St Louis, MO, USA), mouse anti-HDAC10 antibody (purchased from Santa Cruz, CA, USA), and rabbit monoclonal antibodies against acetyl- group in lysine protein (Abcam, Cambridge, UK). HIV-1 p24 monoclonal antibody was used in western blot and ELISA, which was described in our previous publication. HRP-conjugated donkey anti-rabbit IgG and sheep anti-mouse IgG were used as the secondary antibody, which were purchased from Amersham Biosciences (Mississauga, ON, Canada).HIV-1 (N119 strain, Cat# 1392) was obtained from the national institutes of health (NIH) AIDS research and reference reagent program. Different pNL4.3 viruses were generated by co-transfecting pNL4.3 expression plasmid with GFP or HDAC10 or HDAC10 H135A plasmid. The concentration of virus or VLP stocks were further quantified by HIV-1 p24 level. For HIV (N119) infection in C8166 and Jurkat cells (or transduced Jurkat cells), which are susceptible to HIV infection, we infected cells with 1 ng or 5 ng of HIV-1 (MOI of 0.1 or 0.5). Co-Immunoprecipitation (Co-IP) Assay - 293T cells were transfected with GFP-INwt/mut and HDAC10-Myc or HDAC6-FLAG plasmids. After 48 h, cells were lysed with RIPA buffer supplemented with protease inhibitor for 30 min on the ice and the lysates were clarified by centrifugation (13,000 rpm for 30 min at 4 °C). Cell lysates were immunoprecipitated with rabbit anti-GFP or mouse anti-Myc antibody. The bound proteins were detected by a WB using anti-HDAC10, anti-HDAC6, or anti-GFP antibody, respectively. The interaction between HIV-1 IN-YFP and T7-Ku70 was detected by immunoprecipitation with rabbit anti-GFP followed by WB using anti-T7 to detect bound T7-Ku70 protein. For the interaction between HIV-1 IN-YFP and T7-LEDGF, transfected cells were lysed by CSK buffer (0.5% NP-40, 10 mMPipes pH 6.8, 10% (w/v) sucrose, 1 mM DTT, 1 mM MgCl2, 400 mM NaCl, and protease inhibitor) for 30 min on the ice. Cell lysates were immune-precipitated with rabbit anti-GFP antibody and followed by WB using anti-T7 to detect bound T7-LEDGF protein. Then, 2% of transfected cell lysates were used to detect the expression of different proteins by WB using corresponding antibodies.
cc29d2f7-299b-4165-9634-1ce530e707293188818131888181IОєBОµproteinNF-ОєBproteinunknownWe utilized a latently infected promonocytic cell line, U1 [68] derived from chronically infected U937, and lymphocytic cell lines J1.1 and ACH-2 cellsImmunoblotting. Chromatin Immunoprecipitation Assay (ChIP) - Chromatin immunoprecipitation (ChIP) assays were performed using ChIP-IT Express Enzymatic Kit (ActiveMotif, Carlsbad, CA, USA). HIV-1 RNA Quantitation - Total RNA was extracted from the cell pellets 24 h after siRNA transfection, using an RNeasy Mini Kit (Qiagen). The extracted RNA was quantified using a NanoDrop HD1000 Spectrophotometer (Thermo Scientific). The purity of the RNA samples was estimated based on the 260:280 absorbance ratio, and samples were required to have ratios ≥2. 500–750 µg of total RNA per sample was used for reverse transcription reactions using iScriptTM Reverse Transcription Supermix for qRT-PCR (Bio-Rad). Quantitative data was extracted from gel images using ImageJ version 2.0.0-rc-69/1.52p, using the FIJI interface, with included plugins.
1142bf3b-21d4-4179-985c-d4fb5368ac273188818131888181NF-ОєBproteinIОєBО±proteinunknownWe utilized a latently infected promonocytic cell line, U1 [68] derived from chronically infected U937, and lymphocytic cell lines J1.1 and ACH-2 cellsImmunoblotting. Chromatin Immunoprecipitation Assay (ChIP) - Chromatin immunoprecipitation (ChIP) assays were performed using ChIP-IT Express Enzymatic Kit (ActiveMotif, Carlsbad, CA, USA). HIV-1 RNA Quantitation - Total RNA was extracted from the cell pellets 24 h after siRNA transfection, using an RNeasy Mini Kit (Qiagen). The extracted RNA was quantified using a NanoDrop HD1000 Spectrophotometer (Thermo Scientific). The purity of the RNA samples was estimated based on the 260:280 absorbance ratio, and samples were required to have ratios ≥2. 500–750 µg of total RNA per sample was used for reverse transcription reactions using iScriptTM Reverse Transcription Supermix for qRT-PCR (Bio-Rad). Quantitative data was extracted from gel images using ImageJ version 2.0.0-rc-69/1.52p, using the FIJI interface, with included plugins.
d7bf45de-2699-4206-9334-babee69d21ea3198061431980614gp41proteingp120proteinunknownBG505 N332 SOSIP gp140 envelope production was performed with Freestyle293 cells (ThermoFisher Cat No.). Cryo-EM imaging was performed on a FEI Titan Krios microscope (Thermo Fisher Scientific) operated at 300 kV. Initial data processing was performed within cryoSPARC35 including particle picking, multiple rounds of 2D classification, ab initio reconstruction, homogeneous map refinement, and non-uniform map refinement, yielding 3.5 Å and 3.7 Å maps for the BG505-F14-SOSIP and the BG505-F14/Vt8-SOSIP complexes, respectively. Structure fitting of the cryo-EM maps was performed in Chimera63 using the gp120 and gp41 segments from PDB ID 5CEZ (chains G and B, respectively) with F14 and Vt8 mutations added using PyMol. Coordinates for VRC01, VRC03, and 10-1074 were obtained from PDB ID 3NGB (chains H and L), PDB ID 3SE8 (chains H and L), and PDB ID 5T3Z (chains H and L), respectively. Initial coordinate refinement was performed using Rosetta.
b15563dd-9a44-4c20-b79d-c31141c083523198061431980614CD4proteinEnv trimerproteinunknownBG505 N332 SOSIP gp140 envelope production was performed with Freestyle293 cells (ThermoFisher Cat No.). Surface plasmon resonance - Triggering of SOSIP gp140 Envs by soluble CD4 (sCD4) was monitored via surface Plasmon resonance and was performed on a BIAcore 3000 instrument (GE Healthcare). Thermal denaturation - Thermal denaturation experiments were performed using the NanoDSC platform (TA Instruments). Samples were dialyzed into HEPES buffered saline (HBS; 10 mM HEPES, 150 mM NaCl, pH 7.4), diluted in dialysate to 0.2 to 0.4 mg/ml, and degassed for 15 min.
f0c95dbe-c8a9-47bc-8dc4-cf55819cb9a73201663532016635TatproteinTat-SF1proteinunknownHeLa cells were obtained from American Type Culture Collection (ATCC) and cultured in DMEM containing 10% FBS at 37 °C with 5% CO2. For transfection experiments, 300,000 cells were plated per well of a six-well plate. Approximately 24 h later, cells were transfected with 500 ng of a pSUPER vector expressing an shRNA specifc to TatSF1 [37] or a linearized pEGFP-C1 plasmid (Clonetech) as a negative control that did not express an shRNA.Western blotting - HeLa cells were harvested 48 h post-transfection with TatSF1 shRNAs. RIPA lysis bufer was used in conjunction with sonication to create protein lysates. Total protein concentration was determined with a DC Protein Assay (BioRad). RT‑qPCR - Five hundred nanograms of RNA was reverse transcribed with New England Bio Labs LunaScript RT SuperMix kit according to manufacturer’s instructions. Reactions lacking reverse transcriptase were included for each RNA sample to ensure plasmid and genomic DNA contamination were negligible. Potential Tat-SF1 binding motifs were mapped to the HIV-1 reference genome with GenBank accession number AF033819.3 using Geneious bioinformatics software. RNA probes were synthesized by in vitro transcription. For the WT TAR (1–104) probe, a DNA template containing the HIV-1 genome was PCR-amplifed. HeLa nuclear extract was prepared using NE-PER nuclear and cytoplasmic extraction reagents (Thermo Scientifc). Electrophoretic mobility shift assays (EMSA) gel-loading solution (Molecular Probes) was added to each binding reaction before loading on a 1% agarose gel in 0.5× TBE. Fluorescence correlation spectroscopy - The fuorescein-labeled free HIV-1 RNA probe, probe with nuclear extract, or a fuorescein only control was deposited as a single drop on three separate Sigmacote (Millipore Sigma) treated coverslips mounted in Attofuor coverslip chambers (Invitrogen).
cbd3f2f7-cd46-4225-8f98-f494b8e0a9333205110932051109TRBPproteinDicerproteinunknownHuman cervical cancer cell-derived HeLa cells, kindly supplied from Hiroyuki Sasaki at Kyushu University, Japan, were cultured in Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% inactivated fetal bovine serum (FBS) at 37°C with 5% CO2. Human embryonic kidney cell-derived Flp-In T-REX 293 cells (Life Technologies) were cultured in DMEM containing 10% heat-inactivated Tet-system approved FBS (Clontech) without tetracycline and 10 ng/ml of Hygromycin B at 37°C with 5% CO2A wild-type TRBP expression construct (pcDNA5-TRBP-WT) containing a full length TRBP (Takahashi et al., 2013) at the NheI/HindIII sites of pcDNA5-FRT-TO-FLAG/HA-B (Okada-Katsuhata et al., 2012) was used as a template. A mutant TRBP-L326A expression construct, in which leucine at position 326 was replaced with alanine, was generated using primers (Table S1) and KOD-Plus-Mutagenesis Kit (TOYOBO) by site-directed mutagenesis method. In addition, a single amino acid mutant of TRBP-Y358A, double amino acids mutants of TRBP-L326A/V336A and TRBP-V336A/H338A, triple mutants of TRBP-V336A/H338A/Y358A and TRBP-L326A/V336A/H338A and a quadruple mutant of TRBP-L326A/V336A/H338A/Y358A were also constructed by the same procedures using primers. Immunoprecipitation - one day before transfection, TRBP−/− HeLa cells were inoculated at 6.0×105 cells/well in a six-well cell culture plate. Cells were transfected with each TRBP expression plasmid with Lipofectamine 2000 (Invitrogen). Twenty-four hours after transfection, cells were washed with PBS and lysed in cold lysis Buffer. RNasin Plus Ribonuclease Inhibitor (0.03 units/μl) was added to the lysis buffer to remove RNase. After centrifugation at 15,000 rpm for 10 min, the supernatant was further centrifuged at 48,000 rpm for 30 min. An aliquot of the recovered supernatant was used as an input sample. Immunoprecipitation was performed as previously reported. Western blot - The first antibodies used were anti-FLAG antibody (1/1000, Cell Signaling Technology), anti-Dicer antibody (1/500) (Doi et al., 2003), anti-ribose polymerase (PARP) antibody (1/1000, abcam), anti-Caspase-3 antibody (1/400, abcam), anti-β-actin antibody (1/1000, Sigma-Aldrich). The second antibodies were Anti-rabbit IgG (1/5000, GE Healthcare) or Anti-mouse IgG (1/5000, GE Healthcare) labelled with HRP. Dual luciferase reporter assay to measure RNAi activity. Preparation of ΔTAR luciferase expression plasmid. Translational activity assay using luciferase reporter. Real-time PCR. Northern blot. Apoptosis assay.
121d3f74-2f2b-4849-868a-ccdf96cf08db3211964432119644NefproteinMRproteinunknownThe following molecular clones were obtained via the AIDS Reagent Program: p89.6 [cat# 3552 from Dr. Ronald G. Collman), pNL4-3 (cat# 114 from Dr. Malcolm Martin), pREJO.c/2864 (cat# 11746 from Dr. John Kappes and Dr. Christina Ochsenbauer) and pYU2 (cat# 1350 from Dr. Beatrice Hahn and Dr. George Shaw). Vpr-null versions of 89.6, NL4-3, and YU2 were created by cutting the AflII site within vpr and filling in with Klenow fragment. The vpr-null version of REJO was created by doing the same at the AvrII site. A nef-null version of 89.6 was created by deleting nef from its start codon to the XhoI site.Virus stocks were obtained by transfecting 293T cells (ATCC, Manassas, Virginia) with viral DNA and polyethylenimine (PEI). Co-transfections of HIV and MR or UNG2 were performed in 293T cells. Prior to infection, 500 µL of medium was removed from each well and this ‘conditioned’ medium was saved to be replaced after the infection. MDM were infected by equal inocula of HIV. MDM were centrifuged at 2500 rpm (1049 x g) for 2 hr at 25°C with equal volume of NL4-3 ∆GPE-GFP or an isogenic mutant in 500 uL total medium. Following infection, medium was removed and replaced with a 1:2 mixture of conditioned medium and fresh R10. Adenovirus was prepared by the University of Michigan Vector Core, and the transduction of MDM was performed as previously described (Leonard et al., 2011) at an MOI of 1000 based on 293T cell infection estimations and the concentration of particles as assessed by OD280. Activated T cells were infected. Flow cytometry - intracellular staining of cells using antibodies directed against HIV Gag p24, MR and FLAG-UNG2 was performed by permeabilizing paraformaldehyde-fixed cells with 0.1% Triton-X in PBS for 5 min, followed by incubation with antibody for 20 min at room temperature. For Gag and MR, PE-conjugated primary antibodies were used. For FLAG-UNG2, cells were stained with a PE-conjugated goat anti-mouse IgG1 secondary antibody for 20 min at room temperature. Quantitative RT-PCR. Immunoblot. Virion quantitation
3a00315a-a321-42a3-aee2-3ae8d4324d203211964432119644VprproteinMRproteinunknownThe following molecular clones were obtained via the AIDS Reagent Program: p89.6 [cat# 3552 from Dr. Ronald G. Collman), pNL4-3 (cat# 114 from Dr. Malcolm Martin), pREJO.c/2864 (cat# 11746 from Dr. John Kappes and Dr. Christina Ochsenbauer) and pYU2 (cat# 1350 from Dr. Beatrice Hahn and Dr. George Shaw). Vpr-null versions of 89.6, NL4-3, and YU2 were created by cutting the AflII site within vpr and filling in with Klenow fragment. The vpr-null version of REJO was created by doing the same at the AvrII site. A nef-null version of 89.6 was created by deleting nef from its start codon to the XhoI site.Virus stocks were obtained by transfecting 293T cells (ATCC, Manassas, Virginia) with viral DNA and polyethylenimine (PEI). Co-transfections of HIV and MR or UNG2 were performed in 293T cells. Prior to infection, 500 µL of medium was removed from each well and this ‘conditioned’ medium was saved to be replaced after the infection. MDM were infected by equal inocula of HIV. MDM were centrifuged at 2500 rpm (1049 x g) for 2 hr at 25°C with equal volume of NL4-3 ∆GPE-GFP or an isogenic mutant in 500 uL total medium. Following infection, medium was removed and replaced with a 1:2 mixture of conditioned medium and fresh R10. Adenovirus was prepared by the University of Michigan Vector Core, and the transduction of MDM was performed as previously described (Leonard et al., 2011) at an MOI of 1000 based on 293T cell infection estimations and the concentration of particles as assessed by OD280. Activated T cells were infected. Flow cytometry - intracellular staining of cells using antibodies directed against HIV Gag p24, MR and FLAG-UNG2 was performed by permeabilizing paraformaldehyde-fixed cells with 0.1% Triton-X in PBS for 5 min, followed by incubation with antibody for 20 min at room temperature. For Gag and MR, PE-conjugated primary antibodies were used. For FLAG-UNG2, cells were stained with a PE-conjugated goat anti-mouse IgG1 secondary antibody for 20 min at room temperature. Quantitative RT-PCR. Immunoblot. Virion quantitation
ea601ebc-63ed-49c0-9127-a643e61abeb43211964432119644EnvproteinMRproteinunknownThe following molecular clones were obtained via the AIDS Reagent Program: p89.6 [cat# 3552 from Dr. Ronald G. Collman), pNL4-3 (cat# 114 from Dr. Malcolm Martin), pREJO.c/2864 (cat# 11746 from Dr. John Kappes and Dr. Christina Ochsenbauer) and pYU2 (cat# 1350 from Dr. Beatrice Hahn and Dr. George Shaw). Vpr-null versions of 89.6, NL4-3, and YU2 were created by cutting the AflII site within vpr and filling in with Klenow fragment. The vpr-null version of REJO was created by doing the same at the AvrII site. A nef-null version of 89.6 was created by deleting nef from its start codon to the XhoI site.Virus stocks were obtained by transfecting 293T cells (ATCC, Manassas, Virginia) with viral DNA and polyethylenimine (PEI). Co-transfections of HIV and MR or UNG2 were performed in 293T cells. Prior to infection, 500 µL of medium was removed from each well and this ‘conditioned’ medium was saved to be replaced after the infection. MDM were infected by equal inocula of HIV. MDM were centrifuged at 2500 rpm (1049 x g) for 2 hr at 25°C with equal volume of NL4-3 ∆GPE-GFP or an isogenic mutant in 500 uL total medium. Following infection, medium was removed and replaced with a 1:2 mixture of conditioned medium and fresh R10. Adenovirus was prepared by the University of Michigan Vector Core, and the transduction of MDM was performed as previously described (Leonard et al., 2011) at an MOI of 1000 based on 293T cell infection estimations and the concentration of particles as assessed by OD280. Activated T cells were infected. Flow cytometry - intracellular staining of cells using antibodies directed against HIV Gag p24, MR and FLAG-UNG2 was performed by permeabilizing paraformaldehyde-fixed cells with 0.1% Triton-X in PBS for 5 min, followed by incubation with antibody for 20 min at room temperature. For Gag and MR, PE-conjugated primary antibodies were used. For FLAG-UNG2, cells were stained with a PE-conjugated goat anti-mouse IgG1 secondary antibody for 20 min at room temperature. Quantitative RT-PCR. Immunoblot. Virion quantitation
0554cbb0-e1e3-4bd7-b191-386ac7d3cec53218754832187548CypAproteinHIV-1 capsidproteinunknownThis study generated the following new plasmids: pET11A-A14C/E45C/A92E, pET11A-A14C/E45C/G94D, HIV-1-P90A, HIV-1-G89V, HIV-1-A92E and HIV-1-G94D.Infection using HIV-1-GFP reporter viruses. Assembly of stabilized HIV-1 capsid tubes. Human HEK293T cells were transfected for 24 h with a plasmid expressing the protein of interest (TRIM5αhu or TRIM5αrh). Capsid binding assay using in vitro assembled HIV-1 CA-NC complexes. Knockdown of TRIM5α expression in Jurkat cells. Generation of TRIM5α knockout HT1080 cell line. CRISPR-Cas9 Knock-outs in Primary CD4+ T Cells. Detection of Reverse Transcripts, 2-LTR circles, and integration in CD4+ T cells. Western blot analysis.
55ea4bc8-e13f-4004-afb6-0a75644f9c153232572932325729VpuproteintetherinproteinunknownTissue culture media and supplements were from Life Technologies (Paisley, UK), fetal calf serum (FCS) from PAA (Little Chalfont, UK), human AB serum from PAA and Sigma-Aldrich (Dorset, UK), and tissue culture plastic from Thermo Fisher Scientific (Waltham, MA, USA) and TPP (Trasadingen, Switzerland). DNA-modifying enzymes were from Promega (Southampton, UK) and chemicals from Sigma-Aldrich, unless specified otherwise. Antibodies to HIV-1 p24/p55 Gag (38:96K and EF7), HIV-1 Env (b12 and 2G12) and HIV-1 Nef (2/81c/2j), as well as antiserum to HIV-1 p24/p55 Gag (ARP432), were obtained from the NIBSC Centre for AIDS Reagents (South Mimms, UK), and rabbit antiserum to BST-2/tetherin (cat. No. 11721) from the NIH AIDS Reagent Program (Germantown, MD, USA). Sheep antiserum to HIV-1 Nef was provided by M. Harris (University of Leeds, UK), rabbit antiserum to Vpu (U2-2) by K. Strebel (NIAID, Bethesda, MD, USA), and anti-vesicular stomatitis virus glycoprotein (VSVG) (P5D4) by T. Kreis (UNIGE, Geneva, Switzerland). Anti-adaptin γ (clone 88) was from BD Biosciences (Oxford, UK), polyclonal anti-BST-2/tetherin (B02P) from Abnova (Taipei, Taiwan), anti-CD81 (M38) from Abcam (Cambridge, UK), anti-HRP from Jackson ImmunoResearch (West Grove, PA, USA), anti-p65 from Santa Cruz Biotechnology (Heidelberg, Germany), anti-TGN46 (AHP500G) from AbD Serotec (Kidlington, UK), Alexa Fluor-conjugated antibodies from Life Technologies, highly cross-adsorbed DyLight 405-conjugated goat anti-mouse, as well as HRP-conjugated antibodies, from Thermo Fisher Scientific, and IRDye secondary reagents from Li-COR Biosciences (Cambridge, UK). The HIV-1 molecular clones AD8(+), AD8(−) and AD8(Udel2) were provided by K. Strebel (NIAID, Bethesda, MD, USA) [26]. To obtain AD8(+)ΔNef, AD8(−)ΔNef and AD8(Udel2)ΔNef, the third methionine codon in Nef was disrupted by introducing an adenine at nucleotide position 60, which causes a frameshift and a premature stop codon ten nucleotides downstream. Stocks of vesicular stomatitis virus glycoprotein (VSVG)-pseudotyped HIV-1 AD8 were prepared by co-transfecting HEK 293T cells with proviral and VSVG DNA for two days and then clearing the culture supernatants of cell debris by centrifugation.p24 ELISA Assay. Single-Cycle Infectivity Assay. Cells, Transfections and Infections. Western Blot Analysis. Flow Cytometry Analysis. Intracellular Tetherin Immunofluorescence. Cell Surface Tetherin Immunofluorescence. Standard errors of the mean (SEM) and p-values are based on all replicates of at least three independent experiments. The p-values were calculated using the unpaired Student’s t-test, unless indicated otherwise.
34c2cef3-e341-44d5-a1e2-537ae31f4d393271945732719457class I MHCproteinNefproteinunknownGene of rat α adaptin is a kind gift from Dr. Juan Bonifacino (NIH). Genes of β2, μ2, and σ2 adaptins were amplified from a cDNA library of human HEK293T cells. For cross-linking mass spectrometry analysis, anhydrous dimethyl sulfoxide (DMSO), disuccinimidyl sulfoxide (DSSO), MS-grade trypsin, HPLC-grade water, formic acid, and acetonitrile were all purchased from Thermo Fisher Scientific. 4–20% TGX SDS-PAGE gels were purchased from Bio-Rad. MS-safe AcquaStain was purchased from Bulldog Bio.Cloning, expression, and purification of proteins. In vitro GST pulldown assay. Fluorescence polarization (FP) assay. Crystallization and crystallographic data collection. Structure determination and refinement. CD4 downregulation assays. Class I MHC downregulation assays. DSSO-based cross-linking mass spectrometry analysis (XL-MS). Integrative structure modeling of the Nef-CD4CD-AP2Δμ2-CTD complex.
3eb0ada1-00bf-4a4d-9b8e-659e43ecf8703271945732719457CD4proteinNefproteinunknownGene of rat α adaptin is a kind gift from Dr. Juan Bonifacino (NIH). Genes of β2, μ2, and σ2 adaptins were amplified from a cDNA library of human HEK293T cells. For cross-linking mass spectrometry analysis, anhydrous dimethyl sulfoxide (DMSO), disuccinimidyl sulfoxide (DSSO), MS-grade trypsin, HPLC-grade water, formic acid, and acetonitrile were all purchased from Thermo Fisher Scientific. 4–20% TGX SDS-PAGE gels were purchased from Bio-Rad. MS-safe AcquaStain was purchased from Bulldog Bio.Cloning, expression, and purification of proteins. In vitro GST pulldown assay. Fluorescence polarization (FP) assay. Crystallization and crystallographic data collection. Structure determination and refinement. CD4 downregulation assays. Class I MHC downregulation assays. DSSO-based cross-linking mass spectrometry analysis (XL-MS). Integrative structure modeling of the Nef-CD4CD-AP2Δμ2-CTD complex.
f62353eb-3e86-4f05-a4d2-3e4c3d02103b3271945732719457clathrin- and adaptor protein complex 2proteinNefproteinunknownGene of rat α adaptin is a kind gift from Dr. Juan Bonifacino (NIH). Genes of β2, μ2, and σ2 adaptins were amplified from a cDNA library of human HEK293T cells. For cross-linking mass spectrometry analysis, anhydrous dimethyl sulfoxide (DMSO), disuccinimidyl sulfoxide (DSSO), MS-grade trypsin, HPLC-grade water, formic acid, and acetonitrile were all purchased from Thermo Fisher Scientific. 4–20% TGX SDS-PAGE gels were purchased from Bio-Rad. MS-safe AcquaStain was purchased from Bulldog Bio.Cloning, expression, and purification of proteins. In vitro GST pulldown assay. Fluorescence polarization (FP) assay. Crystallization and crystallographic data collection. Structure determination and refinement. CD4 downregulation assays. Class I MHC downregulation assays. DSSO-based cross-linking mass spectrometry analysis (XL-MS). Integrative structure modeling of the Nef-CD4CD-AP2Δμ2-CTD complex.
a0d254ae-cc01-48d4-8331-c346de21b8133260039932600399NUP358proteinCAproteinunknownHuman MxB (NM_002463.1) lentiviral vector (pLV-MxB-EF1-GP), lentiviral packaging plasmids including envelope expressing plasmid psPAX2 and VSV-G envelope expressing plasmid pMD2.G were purchased from Fitgene. CPSF6 (NCBI Reference Sequence: NP_008938.2) fused to N-terminal FLAG epitope was cloned into the pCMV-Tag2B vector (Clontech) using BamHΙ and XhoI site. Wild type or mutant MxB fused to C-terminal HA epitope was cloned in the pCMV-C-HA vector (Clontech) using BamHΙ and XhoI site. The HIV-1 NL4-3 molecular clone and HIV-Luc construct (pNL4-3-Luc-R-E-) were obtained from the NIH AIDS reagent program. The N74D point mutation was created by recombinant PCR site directed mutagenesis of the Gag in the vector pNL4-3. The complete viral fragment was sequenced to confirm mutation and exclude additional mutations. Mutant BssHII-ApaI fragment was recloned into pNL4-3 and HIV-Luc constructs and mutation was confirmed by sequence analysis.RNAi interference. PF74 treatment. Western blotting. Co-immunoprecipitation assays. Co-immunoprecipitation assays. Real-time PCR to detect HIV-1 reverse transcription products. Where appropriate, data are expressed as mean ± SD of triplicate cultures. Count data from immunofluorescence confocal assay with more than two groups were analysed by Kruskal–Wallis test. All other grouped data were analysed by one-way ANOVA. Statistical analysis was performed with GraphPad InStat statistical software (GraphPad Software, La Jolla, CA, USA). Statistical significance was defined as p < 0.05.
74e91dee-ef03-4a98-8ec9-82d59f9ca15c3260039932600399MxBproteinNUP358proteinunknownHuman MxB (NM_002463.1) lentiviral vector (pLV-MxB-EF1-GP), lentiviral packaging plasmids including envelope expressing plasmid psPAX2 and VSV-G envelope expressing plasmid pMD2.G were purchased from Fitgene. CPSF6 (NCBI Reference Sequence: NP_008938.2) fused to N-terminal FLAG epitope was cloned into the pCMV-Tag2B vector (Clontech) using BamHΙ and XhoI site. Wild type or mutant MxB fused to C-terminal HA epitope was cloned in the pCMV-C-HA vector (Clontech) using BamHΙ and XhoI site. The HIV-1 NL4-3 molecular clone and HIV-Luc construct (pNL4-3-Luc-R-E-) were obtained from the NIH AIDS reagent program. The N74D point mutation was created by recombinant PCR site directed mutagenesis of the Gag in the vector pNL4-3. The complete viral fragment was sequenced to confirm mutation and exclude additional mutations. Mutant BssHII-ApaI fragment was recloned into pNL4-3 and HIV-Luc constructs and mutation was confirmed by sequence analysis.RNAi interference. PF74 treatment. Western blotting. Co-immunoprecipitation assays. Co-immunoprecipitation assays. Real-time PCR to detect HIV-1 reverse transcription products. Where appropriate, data are expressed as mean ± SD of triplicate cultures. Count data from immunofluorescence confocal assay with more than two groups were analysed by Kruskal–Wallis test. All other grouped data were analysed by one-way ANOVA. Statistical analysis was performed with GraphPad InStat statistical software (GraphPad Software, La Jolla, CA, USA). Statistical significance was defined as p < 0.05.
7b04d8a5-c1e2-4585-bff7-50c25d05abd23260039932600399MxBproteincleavage and polyadenylation specificity factor subunit 6proteinunknownHuman MxB (NM_002463.1) lentiviral vector (pLV-MxB-EF1-GP), lentiviral packaging plasmids including envelope expressing plasmid psPAX2 and VSV-G envelope expressing plasmid pMD2.G were purchased from Fitgene. CPSF6 (NCBI Reference Sequence: NP_008938.2) fused to N-terminal FLAG epitope was cloned into the pCMV-Tag2B vector (Clontech) using BamHΙ and XhoI site. Wild type or mutant MxB fused to C-terminal HA epitope was cloned in the pCMV-C-HA vector (Clontech) using BamHΙ and XhoI site. The HIV-1 NL4-3 molecular clone and HIV-Luc construct (pNL4-3-Luc-R-E-) were obtained from the NIH AIDS reagent program. The N74D point mutation was created by recombinant PCR site directed mutagenesis of the Gag in the vector pNL4-3. The complete viral fragment was sequenced to confirm mutation and exclude additional mutations. Mutant BssHII-ApaI fragment was recloned into pNL4-3 and HIV-Luc constructs and mutation was confirmed by sequence analysis.RNAi interference. PF74 treatment. Western blotting. Co-immunoprecipitation assays. Co-immunoprecipitation assays. Real-time PCR to detect HIV-1 reverse transcription products. Where appropriate, data are expressed as mean ± SD of triplicate cultures. Count data from immunofluorescence confocal assay with more than two groups were analysed by Kruskal–Wallis test. All other grouped data were analysed by one-way ANOVA. Statistical analysis was performed with GraphPad InStat statistical software (GraphPad Software, La Jolla, CA, USA). Statistical significance was defined as p < 0.05.
768b46c5-0710-4633-bc69-71525897ee3c3260039932600399Mx2/MxBproteinHIV-1 capsidproteinunknownHuman MxB (NM_002463.1) lentiviral vector (pLV-MxB-EF1-GP), lentiviral packaging plasmids including envelope expressing plasmid psPAX2 and VSV-G envelope expressing plasmid pMD2.G were purchased from Fitgene. CPSF6 (NCBI Reference Sequence: NP_008938.2) fused to N-terminal FLAG epitope was cloned into the pCMV-Tag2B vector (Clontech) using BamHΙ and XhoI site. Wild type or mutant MxB fused to C-terminal HA epitope was cloned in the pCMV-C-HA vector (Clontech) using BamHΙ and XhoI site. The HIV-1 NL4-3 molecular clone and HIV-Luc construct (pNL4-3-Luc-R-E-) were obtained from the NIH AIDS reagent program. The N74D point mutation was created by recombinant PCR site directed mutagenesis of the Gag in the vector pNL4-3. The complete viral fragment was sequenced to confirm mutation and exclude additional mutations. Mutant BssHII-ApaI fragment was recloned into pNL4-3 and HIV-Luc constructs and mutation was confirmed by sequence analysis.RNAi interference. PF74 treatment. Western blotting. Co-immunoprecipitation assays. Co-immunoprecipitation assays. Real-time PCR to detect HIV-1 reverse transcription products. Where appropriate, data are expressed as mean ± SD of triplicate cultures. Count data from immunofluorescence confocal assay with more than two groups were analysed by Kruskal–Wallis test. All other grouped data were analysed by one-way ANOVA. Statistical analysis was performed with GraphPad InStat statistical software (GraphPad Software, La Jolla, CA, USA). Statistical significance was defined as p < 0.05.
26b2fc94-4f5b-4559-8ad4-8b682538f2d03260039932600399MxBproteinNUP358proteinunknownHuman MxB (NM_002463.1) lentiviral vector (pLV-MxB-EF1-GP), lentiviral packaging plasmids including envelope expressing plasmid psPAX2 and VSV-G envelope expressing plasmid pMD2.G were purchased from Fitgene. CPSF6 (NCBI Reference Sequence: NP_008938.2) fused to N-terminal FLAG epitope was cloned into the pCMV-Tag2B vector (Clontech) using BamHΙ and XhoI site. Wild type or mutant MxB fused to C-terminal HA epitope was cloned in the pCMV-C-HA vector (Clontech) using BamHΙ and XhoI site. The HIV-1 NL4-3 molecular clone and HIV-Luc construct (pNL4-3-Luc-R-E-) were obtained from the NIH AIDS reagent program. The N74D point mutation was created by recombinant PCR site directed mutagenesis of the Gag in the vector pNL4-3. The complete viral fragment was sequenced to confirm mutation and exclude additional mutations. Mutant BssHII-ApaI fragment was recloned into pNL4-3 and HIV-Luc constructs and mutation was confirmed by sequence analysis.RNAi interference. PF74 treatment. Western blotting. Co-immunoprecipitation assays. Co-immunoprecipitation assays. Real-time PCR to detect HIV-1 reverse transcription products. Where appropriate, data are expressed as mean ± SD of triplicate cultures. Count data from immunofluorescence confocal assay with more than two groups were analysed by Kruskal–Wallis test. All other grouped data were analysed by one-way ANOVA. Statistical analysis was performed with GraphPad InStat statistical software (GraphPad Software, La Jolla, CA, USA). Statistical significance was defined as p < 0.05.
27955099-36cc-4245-a1eb-313bc83c42b93254479332544793EnvproteinCD4-MBL-R5Nt CARproteinunknownNon-commercial, two types of tannins: stiff 2,4-valoneoyl-3,6-hexahydroxydiphenoyl-β-D-glucose (tannin 1, T1) isolated from Euphorbia rosularis A.Teod. and flexible 1,2-di-O-galloyl-3,6-valoneoyl-β-D-glucose (tannin 2, T2) obtained from Euphorbia Triodonta Prokh. (Table 1). Human serum albumin (HSA), 1,2-dimyristoyl-sn-glycero-3-phosphocholine (DMPC), 1,6-diphenyl-1,3,5-hexatriene (DPH) and PBS in tablets were from Sigma-Aldrich, St. Louis MO, USA. Cysteamine (2- aminoethanothiol) obtained from Sigma Steinheim (Germany) whereas HBS-ES buffer pH = 7.4 (0.01 M HEPES, 0.15 M sodium chloride, 0.005 % Tween20, 3 mM EDTA) and absolute ethanol 99.8 % were from POCh (Gliwice, Poland). All other chemicals were of analytical grade. Tannins were dissolved in DMSO at the concentration C = 20 mM (stock solution) and kept in 4 °C. For experiments they were diluted in filtrated water (with conductivity below 0.2 μS) to C = 1.5 mM (for fluorescence analysis) and to C = 1 mM (for zeta-potential analysis). Human serum albumin was dissolved in PBS (pH = 7.4, 10 mM) at the initial concentration 100 μM and diluted to C = 2 μM for analysis (before each experiment the fresh HSA solution was prepared). PBS was dissolved in water and pH was verified to be sure that pH = 7.4 for temperatures 23 °C (296 K), 30 °C (303 K) and 37 °C (310 K).Molecular modeling and quantum chemical properties of used compounds. Fluorescence analysis of HSA-tannin interaction. Zeta potential analysis. Surface plasmon resonance imaging (SPRi). Analysis of tannins partition coefficient. Experiments were performed at least 4 independent experiments. Values presented as mean ± SD. To verify if received raw data values were not outlying from the rest, Grubb's test was used. For statistical analysis GraphPad software QuickCalcs
f9aedd6f-a312-426b-84f5-4310f002dd093242416532424165TatproteinTLR4proteinunknownPeripheral Blood Mononuclear Cells (PBMCs) were isolated from buffy coat of healthy donors obtained from the EFS Toulouse Purpan, France. HeLa and HEK cell lines stably expressing human TLR4, MD2 and CD14 or HEK and HeLa null control were purchased from Imgenex, Novus Biologicals and Invivogen respectively, and maintained in culture according to the manufacturer’s instructions. Recombinant Tat protein from HIV-1 group M subtype B (isolate SF2) (www.uniprot.org/uniprot/P04614) full length protein (Tat 1-101), core domain (Tat 30-72) or N-terminal Tat fragments (Tat 1-45) fused to glutathione S-transferase (GST). Chemical products: Lipopolysaccharide (LPS), from E. coli serotype R515, was purchased from Alexis biochemicals. LPS-RS, from Rhodobacter sphaeroides and CLI-095 were purchased from Invivogen. The NF-κB inhibitor Bay 11-7082 was purchased from Calbiochem. Recombinant human TLR4/MD2 and CD14 proteins were purchased from R&D system. L-tryptophan, L-Kynurenine, and Ehrlich’s reagent were from Sigma-Aldrich.Treatment of monocyte-derived dendritic cells with Tat. IDO protein expression in MoDCs was investigated by immunoblot and IDO activity was quantified by Ehrlich’s Assay. Molecular assay: Tat-TLR4 binding was investigated following a solid-phase binding assay. Cell binding assay: HEK cells not transfected (HEK Null) or stably transfected with CD14, MD2 and TLR4, (HEK-CD14-MD2-TLR4) were cultured on glass coverslides 12-mm round diameter. NF-κB immunoblot. Quantification of IL-10 cytokine in MoDC supernatant and quantification of human CXCL8 chemokine in HEK and HeLa cell’s supernatants were performed by ELISA. Statistical analysis was performed using GraphPad Prism software v.5. All results are expressed as means +/− SD. All experiments were performed a minimum of three times. Differences in the means for the different groups were tested using one-way ANOVA followed by Bonferroni post hoc test.
7e3eeb46-3a9e-45f6-8b63-3b87333064643242416532424165Tatproteinp65proteinunknownPeripheral Blood Mononuclear Cells (PBMCs) were isolated from buffy coat of healthy donors obtained from the EFS Toulouse Purpan, France. HeLa and HEK cell lines stably expressing human TLR4, MD2 and CD14 or HEK and HeLa null control were purchased from Imgenex, Novus Biologicals and Invivogen respectively, and maintained in culture according to the manufacturer’s instructions. Recombinant Tat protein from HIV-1 group M subtype B (isolate SF2) (www.uniprot.org/uniprot/P04614) full length protein (Tat 1-101), core domain (Tat 30-72) or N-terminal Tat fragments (Tat 1-45) fused to glutathione S-transferase (GST). Chemical products: Lipopolysaccharide (LPS), from E. coli serotype R515, was purchased from Alexis biochemicals. LPS-RS, from Rhodobacter sphaeroides and CLI-095 were purchased from Invivogen. The NF-κB inhibitor Bay 11-7082 was purchased from Calbiochem. Recombinant human TLR4/MD2 and CD14 proteins were purchased from R&D system. L-tryptophan, L-Kynurenine, and Ehrlich’s reagent were from Sigma-Aldrich.Treatment of monocyte-derived dendritic cells with Tat. IDO protein expression in MoDCs was investigated by immunoblot and IDO activity was quantified by Ehrlich’s Assay. Molecular assay: Tat-TLR4 binding was investigated following a solid-phase binding assay. Cell binding assay: HEK cells not transfected (HEK Null) or stably transfected with CD14, MD2 and TLR4, (HEK-CD14-MD2-TLR4) were cultured on glass coverslides 12-mm round diameter. NF-κB immunoblot. Quantification of IL-10 cytokine in MoDC supernatant and quantification of human CXCL8 chemokine in HEK and HeLa cell’s supernatants were performed by ELISA. Statistical analysis was performed using GraphPad Prism software v.5. All results are expressed as means +/− SD. All experiments were performed a minimum of three times. Differences in the means for the different groups were tested using one-way ANOVA followed by Bonferroni post hoc test.
c3b43130-c44f-4f9f-9fb9-50e0fc1ee17d3242416532424165NF-ОєBproteinIDO-1proteinunknownPeripheral Blood Mononuclear Cells (PBMCs) were isolated from buffy coat of healthy donors obtained from the EFS Toulouse Purpan, France. HeLa and HEK cell lines stably expressing human TLR4, MD2 and CD14 or HEK and HeLa null control were purchased from Imgenex, Novus Biologicals and Invivogen respectively, and maintained in culture according to the manufacturer’s instructions. Recombinant Tat protein from HIV-1 group M subtype B (isolate SF2) (www.uniprot.org/uniprot/P04614) full length protein (Tat 1-101), core domain (Tat 30-72) or N-terminal Tat fragments (Tat 1-45) fused to glutathione S-transferase (GST). Chemical products: Lipopolysaccharide (LPS), from E. coli serotype R515, was purchased from Alexis biochemicals. LPS-RS, from Rhodobacter sphaeroides and CLI-095 were purchased from Invivogen. The NF-κB inhibitor Bay 11-7082 was purchased from Calbiochem. Recombinant human TLR4/MD2 and CD14 proteins were purchased from R&D system. L-tryptophan, L-Kynurenine, and Ehrlich’s reagent were from Sigma-Aldrich.Treatment of monocyte-derived dendritic cells with Tat. IDO protein expression in MoDCs was investigated by immunoblot and IDO activity was quantified by Ehrlich’s Assay. Molecular assay: Tat-TLR4 binding was investigated following a solid-phase binding assay. Cell binding assay: HEK cells not transfected (HEK Null) or stably transfected with CD14, MD2 and TLR4, (HEK-CD14-MD2-TLR4) were cultured on glass coverslides 12-mm round diameter. NF-κB immunoblot. Quantification of IL-10 cytokine in MoDC supernatant and quantification of human CXCL8 chemokine in HEK and HeLa cell’s supernatants were performed by ELISA. Statistical analysis was performed using GraphPad Prism software v.5. All results are expressed as means +/− SD. All experiments were performed a minimum of three times. Differences in the means for the different groups were tested using one-way ANOVA followed by Bonferroni post hoc test.
b3f3486b-2b71-4e1b-a74c-ede21f4d1bb73242416532424165TatproteinNF-ОєBproteinunknownPeripheral Blood Mononuclear Cells (PBMCs) were isolated from buffy coat of healthy donors obtained from the EFS Toulouse Purpan, France. HeLa and HEK cell lines stably expressing human TLR4, MD2 and CD14 or HEK and HeLa null control were purchased from Imgenex, Novus Biologicals and Invivogen respectively, and maintained in culture according to the manufacturer’s instructions. Recombinant Tat protein from HIV-1 group M subtype B (isolate SF2) (www.uniprot.org/uniprot/P04614) full length protein (Tat 1-101), core domain (Tat 30-72) or N-terminal Tat fragments (Tat 1-45) fused to glutathione S-transferase (GST). Chemical products: Lipopolysaccharide (LPS), from E. coli serotype R515, was purchased from Alexis biochemicals. LPS-RS, from Rhodobacter sphaeroides and CLI-095 were purchased from Invivogen. The NF-κB inhibitor Bay 11-7082 was purchased from Calbiochem. Recombinant human TLR4/MD2 and CD14 proteins were purchased from R&D system. L-tryptophan, L-Kynurenine, and Ehrlich’s reagent were from Sigma-Aldrich.Treatment of monocyte-derived dendritic cells with Tat. IDO protein expression in MoDCs was investigated by immunoblot and IDO activity was quantified by Ehrlich’s Assay. Molecular assay: Tat-TLR4 binding was investigated following a solid-phase binding assay. Cell binding assay: HEK cells not transfected (HEK Null) or stably transfected with CD14, MD2 and TLR4, (HEK-CD14-MD2-TLR4) were cultured on glass coverslides 12-mm round diameter. NF-κB immunoblot. Quantification of IL-10 cytokine in MoDC supernatant and quantification of human CXCL8 chemokine in HEK and HeLa cell’s supernatants were performed by ELISA. Statistical analysis was performed using GraphPad Prism software v.5. All results are expressed as means +/− SD. All experiments were performed a minimum of three times. Differences in the means for the different groups were tested using one-way ANOVA followed by Bonferroni post hoc test.
d2bc0581-bc72-4341-b683-185212d22dae3242416532424165IDO-1proteinIFN-ОіproteinunknownPeripheral Blood Mononuclear Cells (PBMCs) were isolated from buffy coat of healthy donors obtained from the EFS Toulouse Purpan, France. HeLa and HEK cell lines stably expressing human TLR4, MD2 and CD14 or HEK and HeLa null control were purchased from Imgenex, Novus Biologicals and Invivogen respectively, and maintained in culture according to the manufacturer’s instructions. Recombinant Tat protein from HIV-1 group M subtype B (isolate SF2) (www.uniprot.org/uniprot/P04614) full length protein (Tat 1-101), core domain (Tat 30-72) or N-terminal Tat fragments (Tat 1-45) fused to glutathione S-transferase (GST). Chemical products: Lipopolysaccharide (LPS), from E. coli serotype R515, was purchased from Alexis biochemicals. LPS-RS, from Rhodobacter sphaeroides and CLI-095 were purchased from Invivogen. The NF-κB inhibitor Bay 11-7082 was purchased from Calbiochem. Recombinant human TLR4/MD2 and CD14 proteins were purchased from R&D system. L-tryptophan, L-Kynurenine, and Ehrlich’s reagent were from Sigma-Aldrich.Treatment of monocyte-derived dendritic cells with Tat. IDO protein expression in MoDCs was investigated by immunoblot and IDO activity was quantified by Ehrlich’s Assay. Molecular assay: Tat-TLR4 binding was investigated following a solid-phase binding assay. Cell binding assay: HEK cells not transfected (HEK Null) or stably transfected with CD14, MD2 and TLR4, (HEK-CD14-MD2-TLR4) were cultured on glass coverslides 12-mm round diameter. NF-κB immunoblot. Quantification of IL-10 cytokine in MoDC supernatant and quantification of human CXCL8 chemokine in HEK and HeLa cell’s supernatants were performed by ELISA. Statistical analysis was performed using GraphPad Prism software v.5. All results are expressed as means +/− SD. All experiments were performed a minimum of three times. Differences in the means for the different groups were tested using one-way ANOVA followed by Bonferroni post hoc test.
7ff06383-74a4-40e0-968b-defc6f5e0a6f3242416532424165TatproteinIDO-1proteinunknownPeripheral Blood Mononuclear Cells (PBMCs) were isolated from buffy coat of healthy donors obtained from the EFS Toulouse Purpan, France. HeLa and HEK cell lines stably expressing human TLR4, MD2 and CD14 or HEK and HeLa null control were purchased from Imgenex, Novus Biologicals and Invivogen respectively, and maintained in culture according to the manufacturer’s instructions. Recombinant Tat protein from HIV-1 group M subtype B (isolate SF2) (www.uniprot.org/uniprot/P04614) full length protein (Tat 1-101), core domain (Tat 30-72) or N-terminal Tat fragments (Tat 1-45) fused to glutathione S-transferase (GST). Chemical products: Lipopolysaccharide (LPS), from E. coli serotype R515, was purchased from Alexis biochemicals. LPS-RS, from Rhodobacter sphaeroides and CLI-095 were purchased from Invivogen. The NF-κB inhibitor Bay 11-7082 was purchased from Calbiochem. Recombinant human TLR4/MD2 and CD14 proteins were purchased from R&D system. L-tryptophan, L-Kynurenine, and Ehrlich’s reagent were from Sigma-Aldrich.Treatment of monocyte-derived dendritic cells with Tat. IDO protein expression in MoDCs was investigated by immunoblot and IDO activity was quantified by Ehrlich’s Assay. Molecular assay: Tat-TLR4 binding was investigated following a solid-phase binding assay. Cell binding assay: HEK cells not transfected (HEK Null) or stably transfected with CD14, MD2 and TLR4, (HEK-CD14-MD2-TLR4) were cultured on glass coverslides 12-mm round diameter. NF-κB immunoblot. Quantification of IL-10 cytokine in MoDC supernatant and quantification of human CXCL8 chemokine in HEK and HeLa cell’s supernatants were performed by ELISA. Statistical analysis was performed using GraphPad Prism software v.5. All results are expressed as means +/− SD. All experiments were performed a minimum of three times. Differences in the means for the different groups were tested using one-way ANOVA followed by Bonferroni post hoc test.
5c038e2b-509c-4c2e-9f8d-9fdd4a3c1e5c3245724132457241CD4proteingp120proteinunknownThe Logo plots for HIV were made using the Analyze Align tool at the HIV database and are based on the WebLogo 3 program. HIV-1 env sequences were obtained from the Los Alamos National Lab (LANL) database. HEK293T human embryonic kidney cells and Cf2Th canine thymocytes (obtained from ATCC), Cf2Th cells stably expressing human CD4 and CCR5 (Cf2Th-CD4/CCR5), primary human peripheral blood mononuclear cells (PBMCs) and CD4+ T cells were isolated, activated, and cultured. Briefly, PBMCs were obtained by leukapheresis and CD4+ T lymphocytes were purified from resting PBMCs by negative selection using immunomagnetic beads per the instructions of the manufacturer (StemCell Technologies, Vancouver, BC, Canada).Flow cytometry analysis of cell surface staining. FACS-based ADCC assay. Protein expression and purification. X-ray crystallography. Data were collected on National Synchrotron Light Source II (NSLS II) highly automated macromolecular crystallography (AMX) beamline 17-ID-1 on an Eiger 9M detector system or on Stanford Synchrotron Radiation Light Source (SSRL) beamline 12-2 on a Dectris Pilatus 6M detector system. Data were integrated and processed with MOSFLM and SCALA from the CCP4 suite or HKL2000. The quality of the final refined models was monitored using the program MolProbity. Structural alignments were performed using the Dali server and the program LSQKAB from the CCP4 suite The PISA webserver was used to determine contact surfaces and residues. All illustrations were prepared with the PyMol molecular graphic suite (DeLano Scientific, San Carlos, CA, USA). The Ramachandran plot was obtained by the use of the validation program “MolProbity” and shows that 92.8 to 97.0% of the total amino acids are in the most favored region, 3 to 6.6% in the generously allowed region, and 0 to 0.6% in the disallowed region, depending on the structure, with better values corresponding to the higher-resolution structures. In silico analysis - starting with the H375S clade A/E HIV-1 core gp120 monomer in PDB entry 4H8W, we generated via residue mutation the WT, H375S, H375T, LM, LM+HS, and LM+HT variants and docked BNM-III-170 to each via alignment to the 5F4P PDB entry. Statistics were analyzed using GraphPad Prism version 6.01 (GraphPad, San Diego, CA, USA). Every data set was tested for statistical normality, and this information was used to apply the appropriate (parametric or nonparametric) statistical test.
dcbf931e-a740-41b5-8b21-1e55af9e107e3252127432521274EnvproteinCD4proteinunknown293T cells were purchased from the ATTC and the TZM-bl cells were obtained from the NIH AIDS Reagent Program. Cf2Th-CD4/CCR5, Cf2Th-CCR5, and Cf2Th-CD4/CXCR4 were generated in the laboratory of Joseph Sodroski. Cell lines were not authenticated. 293T and TZM-bl cells were grown in Dulbecco’s Modified Eagle Medium (DMEM) containing 10% FBS, 100 μg/ml streptomycin and 100 units/ml penicillin. Cf2Th-CD4/CCR5 and Cf2Th-CD4/CXCR4 cells were grown in the same medium supplemented with 400 μg/ml G418 and 200 μg/ml hygromycin B (both from Invitrogen, Carlsbad, CA). Cf2Th-CCR5 cells were grown in the same medium supplemented with 400 μg/ml G418.Viral Infection Assay. Protein Expression and Purification. Kinetic Analysis Measurements of kinetic rate constants for the interactions of HIV-2UC1 sgp125/HIV-1JRFL sgp120 with sCD4 were performed on a Biacore 3000 optical biosensor (General Electric). Cell-cell Fusion Assay Cell-cell fusion was monitored as previously described but using HIV-1 tat as transactivator and TZM-bl cells.
8a46b724-b2aa-42e3-b344-624e9e7a7c3f3276451932764519C-terminal domain of the HIV-1 capsid-spacer peptide 1proteinCA-CTD-SP1proteinunknownAll solvents used in reactions were dried and purified according to standard procedures. The progress of reaction was monitored by thin-layer chromatography (TLC). Acylation reactions were performed in a microwave reactor (Discover SP-D, CEM Corporation, Matthews, NC, USA).Synthesis of 28-Diethoxyphosphorylbetulin. General Method of Synthesis 3-Carboxyacyl Derivatives 3–5. Cytotoxicity For the determination of compounds’ cytotoxicity, CEM-T4 cells were obtained from the NIH AIDS Reagent Program (NIH, US) and were cultured in RPMI supplemented with 10% FCS (Biochrom) and antibiotics at 37 °C in 5% CO2 on 96-well culture plates. Anti-HIV Activity - CEM-T4 cells were preincubated (culture plates with 96 flat bottom wells) for 24 h under standard conditions (37 °C, 5% CO2) and in a standard medium (RPMI, FCS 10%) enriched with tested compounds in the concentration range from 0.02 to 10 μM. Molecular Docking Study - The 3D structures of studied compounds were generated in their low-energy conformation using the Gaussian 16 (revision A.03) computer code with the density functional theory (DFT, B3LYP) and 63–11 + G(d,p) basis sets. Target macromolecules for molecular docking studies were obtained from the Protein Data Bank. Molecular Dynamics Simulations - Appropriate AutoDock Vina output complexes were prepared for simulations using QwikMD built in Visual Molecular Dynamics.
9f7d5811-d3ca-4353-9a99-42bb2e634f7a1762038017620380BH(3)-PMPAppchemicalK65RproteinunknownAll air-sensitive reactions were performed in oven-dried glassware under argon using extra-dry solvents from Aldrich. The 1H, 13C, and 31P nuclear magnetic resonance (NMR) spectra were recorded with a Bruker AMX 250 (250-MHz) mass spectrometer, and the 11B NMR spectrum was recorded with a Bruker AMX 400 mass spectrometer. Chemical shifts are expressed in ppm, and coupling constants (J) are in hertz (s, singlet; bs, broad singlet; d, doublet; dd, double doublet; t, triplet; dt, double triplet; td, triple doublet; qd, quadruple doublet; m, multiplet; dm, double multiplet). Fast atom bombardment mass spectra (MS) and high-resolution MS (HRMS) were obtained on a JEOL SX 102 mass spectrometer using a cesium ion source and a glycerol-thioglycerol matrix. Analytical high-performance liquid chromatography (HPLC) analyses were carried out on a Waters Associates unit equipped with a model 600E multisolvent delivery system, a model 600E controller system, a model Rheodyne sample injector, a 991 photodiode array detector, and an in-line degasser AF. Samples were eluted using a linear gradient of 0.05 M triethylammonium bicarbonate buffer in 100% water (pH 7.5) (buffer A) to a 0.05 M triethylammonium bicarbonate buffer in 50% acetonitrile (buffer B), programmed over a 60-min period with a flow rate of 1 ml/min and detection at 260 nm. All solvents were of HPLC grade and filtered prior to use.The WT RT bacterial expression gene construct p66RTB was used to obtain K65R and R72A RTs as described previously. All constructs were verified by DNA sequencing. The recombinant RTs were coexpressed with HIV-1 protease in Escherichia coli in order to obtain p66/p51 heterodimers, which were later purified using affinity chromatography. All enzymes were quantified by active-site titration before biochemical studies. DNA oligonucleotides were obtained from Life Technologies, United Kingdom. Oligonucleotides were 5′ 32P labeled using T4 polynucleotide kinase (New England Biolabs, MA). [γ-32P]ATP was purchased from Amersham Biosciences. Standard RT activity was assayed using 250 μg activated calf thymus DNA per ml. To determine 50% inhibitory concentration (IC50) values for PMEApp, PMPApp, BH3-PMEApp, and BH3-PMPApp, reactions were performed with 10 nM HIV-1 RT and 5 μM of each dNTP containing 100 μCi per mmol of [3H]dATP, for 15 min with increasing amounts of inhibitor. Each aliquot was spotted in duplicate on DE81 ion-exchange paper disks, and the disks were washed three times for 10 min in 0.3 M ammonium formate, pH 8.0, and two times in ethanol and dried. The radioactivity bound to the filters was determined by liquid scintillation counting. Pre-steady-state kinetics of single nucleotide incorporation into DNA by RT. DNA polymerization rate assays for RTs.
dc5feb37-25eb-4684-9444-224eab90877e1762038017620380BH(3)-PMPAppchemicalR72AproteinunknownAll air-sensitive reactions were performed in oven-dried glassware under argon using extra-dry solvents from Aldrich. The 1H, 13C, and 31P nuclear magnetic resonance (NMR) spectra were recorded with a Bruker AMX 250 (250-MHz) mass spectrometer, and the 11B NMR spectrum was recorded with a Bruker AMX 400 mass spectrometer. Chemical shifts are expressed in ppm, and coupling constants (J) are in hertz (s, singlet; bs, broad singlet; d, doublet; dd, double doublet; t, triplet; dt, double triplet; td, triple doublet; qd, quadruple doublet; m, multiplet; dm, double multiplet). Fast atom bombardment mass spectra (MS) and high-resolution MS (HRMS) were obtained on a JEOL SX 102 mass spectrometer using a cesium ion source and a glycerol-thioglycerol matrix. Analytical high-performance liquid chromatography (HPLC) analyses were carried out on a Waters Associates unit equipped with a model 600E multisolvent delivery system, a model 600E controller system, a model Rheodyne sample injector, a 991 photodiode array detector, and an in-line degasser AF. Samples were eluted using a linear gradient of 0.05 M triethylammonium bicarbonate buffer in 100% water (pH 7.5) (buffer A) to a 0.05 M triethylammonium bicarbonate buffer in 50% acetonitrile (buffer B), programmed over a 60-min period with a flow rate of 1 ml/min and detection at 260 nm. All solvents were of HPLC grade and filtered prior to use.The WT RT bacterial expression gene construct p66RTB was used to obtain K65R and R72A RTs as described previously. All constructs were verified by DNA sequencing. The recombinant RTs were coexpressed with HIV-1 protease in Escherichia coli in order to obtain p66/p51 heterodimers, which were later purified using affinity chromatography. All enzymes were quantified by active-site titration before biochemical studies. DNA oligonucleotides were obtained from Life Technologies, United Kingdom. Oligonucleotides were 5′ 32P labeled using T4 polynucleotide kinase (New England Biolabs, MA). [γ-32P]ATP was purchased from Amersham Biosciences. Standard RT activity was assayed using 250 μg activated calf thymus DNA per ml. To determine 50% inhibitory concentration (IC50) values for PMEApp, PMPApp, BH3-PMEApp, and BH3-PMPApp, reactions were performed with 10 nM HIV-1 RT and 5 μM of each dNTP containing 100 μCi per mmol of [3H]dATP, for 15 min with increasing amounts of inhibitor. Each aliquot was spotted in duplicate on DE81 ion-exchange paper disks, and the disks were washed three times for 10 min in 0.3 M ammonium formate, pH 8.0, and two times in ethanol and dried. The radioactivity bound to the filters was determined by liquid scintillation counting. Pre-steady-state kinetics of single nucleotide incorporation into DNA by RT. DNA polymerization rate assays for RTs.
9745d001-9d81-443a-a314-35fd981f5da21762038017620380BH(3)-PMEAppchemicalK65RproteinunknownAll air-sensitive reactions were performed in oven-dried glassware under argon using extra-dry solvents from Aldrich. The 1H, 13C, and 31P nuclear magnetic resonance (NMR) spectra were recorded with a Bruker AMX 250 (250-MHz) mass spectrometer, and the 11B NMR spectrum was recorded with a Bruker AMX 400 mass spectrometer. Chemical shifts are expressed in ppm, and coupling constants (J) are in hertz (s, singlet; bs, broad singlet; d, doublet; dd, double doublet; t, triplet; dt, double triplet; td, triple doublet; qd, quadruple doublet; m, multiplet; dm, double multiplet). Fast atom bombardment mass spectra (MS) and high-resolution MS (HRMS) were obtained on a JEOL SX 102 mass spectrometer using a cesium ion source and a glycerol-thioglycerol matrix. Analytical high-performance liquid chromatography (HPLC) analyses were carried out on a Waters Associates unit equipped with a model 600E multisolvent delivery system, a model 600E controller system, a model Rheodyne sample injector, a 991 photodiode array detector, and an in-line degasser AF. Samples were eluted using a linear gradient of 0.05 M triethylammonium bicarbonate buffer in 100% water (pH 7.5) (buffer A) to a 0.05 M triethylammonium bicarbonate buffer in 50% acetonitrile (buffer B), programmed over a 60-min period with a flow rate of 1 ml/min and detection at 260 nm. All solvents were of HPLC grade and filtered prior to use.The WT RT bacterial expression gene construct p66RTB was used to obtain K65R and R72A RTs as described previously. All constructs were verified by DNA sequencing. The recombinant RTs were coexpressed with HIV-1 protease in Escherichia coli in order to obtain p66/p51 heterodimers, which were later purified using affinity chromatography. All enzymes were quantified by active-site titration before biochemical studies. DNA oligonucleotides were obtained from Life Technologies, United Kingdom. Oligonucleotides were 5′ 32P labeled using T4 polynucleotide kinase (New England Biolabs, MA). [γ-32P]ATP was purchased from Amersham Biosciences. Standard RT activity was assayed using 250 μg activated calf thymus DNA per ml. To determine 50% inhibitory concentration (IC50) values for PMEApp, PMPApp, BH3-PMEApp, and BH3-PMPApp, reactions were performed with 10 nM HIV-1 RT and 5 μM of each dNTP containing 100 μCi per mmol of [3H]dATP, for 15 min with increasing amounts of inhibitor. Each aliquot was spotted in duplicate on DE81 ion-exchange paper disks, and the disks were washed three times for 10 min in 0.3 M ammonium formate, pH 8.0, and two times in ethanol and dried. The radioactivity bound to the filters was determined by liquid scintillation counting. Pre-steady-state kinetics of single nucleotide incorporation into DNA by RT. DNA polymerization rate assays for RTs.
d9809ba0-80e1-4a13-864e-8383e1cb2f991762038017620380BH(3)-PMEAppchemicalR72AproteinunknownAll air-sensitive reactions were performed in oven-dried glassware under argon using extra-dry solvents from Aldrich. The 1H, 13C, and 31P nuclear magnetic resonance (NMR) spectra were recorded with a Bruker AMX 250 (250-MHz) mass spectrometer, and the 11B NMR spectrum was recorded with a Bruker AMX 400 mass spectrometer. Chemical shifts are expressed in ppm, and coupling constants (J) are in hertz (s, singlet; bs, broad singlet; d, doublet; dd, double doublet; t, triplet; dt, double triplet; td, triple doublet; qd, quadruple doublet; m, multiplet; dm, double multiplet). Fast atom bombardment mass spectra (MS) and high-resolution MS (HRMS) were obtained on a JEOL SX 102 mass spectrometer using a cesium ion source and a glycerol-thioglycerol matrix. Analytical high-performance liquid chromatography (HPLC) analyses were carried out on a Waters Associates unit equipped with a model 600E multisolvent delivery system, a model 600E controller system, a model Rheodyne sample injector, a 991 photodiode array detector, and an in-line degasser AF. Samples were eluted using a linear gradient of 0.05 M triethylammonium bicarbonate buffer in 100% water (pH 7.5) (buffer A) to a 0.05 M triethylammonium bicarbonate buffer in 50% acetonitrile (buffer B), programmed over a 60-min period with a flow rate of 1 ml/min and detection at 260 nm. All solvents were of HPLC grade and filtered prior to use.The WT RT bacterial expression gene construct p66RTB was used to obtain K65R and R72A RTs as described previously. All constructs were verified by DNA sequencing. The recombinant RTs were coexpressed with HIV-1 protease in Escherichia coli in order to obtain p66/p51 heterodimers, which were later purified using affinity chromatography. All enzymes were quantified by active-site titration before biochemical studies. DNA oligonucleotides were obtained from Life Technologies, United Kingdom. Oligonucleotides were 5′ 32P labeled using T4 polynucleotide kinase (New England Biolabs, MA). [γ-32P]ATP was purchased from Amersham Biosciences. Standard RT activity was assayed using 250 μg activated calf thymus DNA per ml. To determine 50% inhibitory concentration (IC50) values for PMEApp, PMPApp, BH3-PMEApp, and BH3-PMPApp, reactions were performed with 10 nM HIV-1 RT and 5 μM of each dNTP containing 100 μCi per mmol of [3H]dATP, for 15 min with increasing amounts of inhibitor. Each aliquot was spotted in duplicate on DE81 ion-exchange paper disks, and the disks were washed three times for 10 min in 0.3 M ammonium formate, pH 8.0, and two times in ethanol and dried. The radioactivity bound to the filters was determined by liquid scintillation counting. Pre-steady-state kinetics of single nucleotide incorporation into DNA by RT. DNA polymerization rate assays for RTs.
f687bb3d-45e7-4740-b0b6-22a81d6f104b3232572932325729tetherinchemicalAD8 Nef HIV-1proteinunknownThe HIV-1 molecular clones AD8(+), AD8(−) and AD8(Udel2) were provided by K. Strebel (NIAID, Bethesda, MD, USA). To obtain AD8(+)ΔNef, AD8(−)ΔNef and AD8(Udel2)ΔNef, the third methionine codon in Nef was disrupted by introducing an adenine at nucleotide position 60, which causes a frameshift and a premature stop codon ten nucleotides downstreamGag p24 levels in cell-free supernatants from HIV-1-infected cells were quantified using the HIV-1 p24CA Antigen Capture Assay Kit. Single-cycle infectivities of HIV-1 AD8 stocks were determined. Single-cycle infectivities of VSVG-pseudotyped HIV-1 AD8 were determined by infecting HeLa cells with serial dilutions of virus stocks for two days and quantifying the proportion of infected cells by flow cytometry, as described below. Western Blot Analysis. Flow Cytometry Analysis. Intracellular Tetherin Immunofluorescence. Cell Surface Tetherin Immunofluorescence. Standard errors of the mean (SEM) and p-values are based on all replicates of at least three independent experiments. The p-values were calculated using the unpaired Student’s t-test, unless indicated otherwise.
bcebc650-99ee-4632-8db4-ddf95d62d8d732544793325447932,4-valoneoyl-3,6-hexahydroxydiphenoyl-ОІ-d-glucosechemicalhuman serum albuminproteinunknownstiff 2,4-valoneoyl-3,6-hexahydroxydiphenoyl-β-D-glucose (tannin 1, T1) isolated from Euphorbia rosularis A.Teod. and flexible 1,2-di-O-galloyl-3,6-valoneoyl-β-D-glucose (tannin 2, T2) obtained from Euphorbia Triodonta Prokh. Human serum albumin (HSA), 1,2-dimyristoyl-sn-glycero-3-phosphocholine (DMPC), 1,6-diphenyl-1,3,5-hexatriene (DPH) and PBS in tablets were from Sigma-Aldrich, St. Louis MO, USA. Cysteamine (2-aminoethanothiol) obtained from Sigma Steinheim (Germany). Tannins were dissolved in DMSO. Human serum albumin was dissolved in PBS. For molecular structure preoptimization we used the method of molecular mechanics MM+. For full molecular structure optimization was applied semi-empirical Austin model 1 (AM1) within Restricted Hartree-Fork Formalism (RHF). Fluorescent measurements were carried out using fluorescence spectrometer (Perkin-Elmer LS-55B, UK). As fluorophore, tryptophan (Trp214) in HSA has been used and fluorescence changes after addition of tannins were analyzed. Zeta potential (ϛ-potential) measurements were done using zetasizer Nano ZS (Malvern, UK). Surface plasmon resonance imaging (SPRi) - SPRi measurements were performed using home-made instrument. Experiments were performed on special biosensor chips. Partition coefficient (Kd) was defined using liposomes labeling with DPH (dissolved in tetrahydrofuran - THF). For statistical analysis GraphPad software QuickCalcs was used.
ef979bf3-5ad5-4633-9801-37c4edcdc5ae32544793325447931,2-di-O-galloyl-3,6-valoneoyl-ОІ-d-glucosechemicalhuman serum albuminproteinunknownstiff 2,4-valoneoyl-3,6-hexahydroxydiphenoyl-β-D-glucose (tannin 1, T1) isolated from Euphorbia rosularis A.Teod. and flexible 1,2-di-O-galloyl-3,6-valoneoyl-β-D-glucose (tannin 2, T2) obtained from Euphorbia Triodonta Prokh. Human serum albumin (HSA), 1,2-dimyristoyl-sn-glycero-3-phosphocholine (DMPC), 1,6-diphenyl-1,3,5-hexatriene (DPH) and PBS in tablets were from Sigma-Aldrich, St. Louis MO, USA. Cysteamine (2-aminoethanothiol) obtained from Sigma Steinheim (Germany). Tannins were dissolved in DMSO. Human serum albumin was dissolved in PBS. For molecular structure preoptimization we used the method of molecular mechanics MM+. For full molecular structure optimization was applied semi-empirical Austin model 1 (AM1) within Restricted Hartree-Fork Formalism (RHF). Fluorescent measurements were carried out using fluorescence spectrometer (Perkin-Elmer LS-55B, UK). As fluorophore, tryptophan (Trp214) in HSA has been used and fluorescence changes after addition of tannins were analyzed. Zeta potential (ϛ-potential) measurements were done using zetasizer Nano ZS (Malvern, UK). Surface plasmon resonance imaging (SPRi) - SPRi measurements were performed using home-made instrument. Experiments were performed on special biosensor chips. Partition coefficient (Kd) was defined using liposomes labeling with DPH (dissolved in tetrahydrofuran - THF). For statistical analysis GraphPad software QuickCalcs was used.
Id PubMed PubMed ID Name obj 1 Type obj 1 Name obj 2 Type obj 2 Interaction Material Method

Warning: include(d://www//include//footer.php): Failed to open stream: No such file or directory in D:\www\hiv-host\nlp\index.php on line 450

Warning: include(): Failed opening 'd://www//include//footer.php' for inclusion (include_path='.;C:\php\pear') in D:\www\hiv-host\nlp\index.php on line 450